Here is a list of all the books I read in 2023, and a short summary of what I thought. The Comfort Crisis - Michael Easter 7/10 I read this as a precursor to some surgery that I was concerned about. It isn’t specifically about surgery, but it helped put me in the right mindset to prepare for discomfort and pain from the surgery. How the World Really Works - Vaclav Smil 5/10 Kind of…
This album is dedicated to a friend of mine. I had a great time with this album, and it’s the first time in my life that I’ve made the time to make an entire album rather than an EP or a single. Spotify Bandcamp
This year, we went to Bali for a family wedding. We spent 2 weeks there together, and I spent a third week by myself in Ubud. The first week was just my wife and I, and we were at a very nice resort on the beach. We spent the week with a mixture of drinking cocktails on the beach and exploring the island on a rented scooter. For those who ride motorcycles, riding in Bali (and SE Asia generally) is…
Here is a list of all the books I read in 2022, and a short summary of what I thought. Klara and the Sun - Kazuo Ishiguro 6/10 This book was fine. It articulates an interesting vision for where AI and robotics could lead us, but isn’t particularly creative or thought provoking in its predictions. As a story of growth and learning, it is also… fine. Worth a read, but not the top of the…
Tada We got married at the Four Seasons in Koh Samui, Thailand. Our closest friends and family were in attendance. I’m not going to add too many pictures because I try to be cautious about what gets put on the internet. I’d happy to share more pictures if you’re interested in seeing them. Here was our room: Samui View Here was the venue: Wedding venue This was our dinner setup
Layering Abstractions There is a standard progression to teaching people music. It looks like this: Notes Scales Chords Modes Chords get moved around in that order depending on the instrument and style of music you’re playing. But here’s the thing… They’re all actually just different sets of the same stuff. The difference is much smaller than I initially imagined.…
What are gene libraries At a high level, gene libraries are collections of DNA fragments from a genome. The library may contain the whole genome, or it may contain only a section of the genome. There are 2 primary kinds of gene libraries Geonmic libraries cDNA libraries Genomic libraries This is the complete collection. If you want all the DNA from an organism, you are going to be creating a…
Why write content? There is so much content on the internet. Why bother to write stuff that others have already written? Even with the vast amount of information on biotech that exists on the internet, it takes me a lot of searching, reading, and messaging to understand the things that I’m writing about. My attempts to write about these topics are intended to help people who are like me -…
What are cosmids? Special plasmids Cosmids are just a specific kind of plasmid, which are indpendent units of DNA that can move between bacteria. That is, they are similar to viruses in that they’re in the gray area of what we might consider “life”, but they are different from viruses in that they do not code for their own protective membrane like a virus or a cell would. One…
Here is a list of all the books I read in 2021, and a short summary of what I thought. The Intelligint Investor - Benjamin Graham 9 / 10 This was a great read. Not a ton of new advice, over other investment books I have read, but it reinvigorated my enthusiasm for lazy investing. Beginner’s Mind - Yo-Yo Ma 7 / 10 This was a pretty light ruad.
Recommendation Do not waste your time. There is so much other, better reading out there. If you’re interested in the works and their historical significance, I’d recommend just reading summaries. There are a few interesting ideas in his works, but if you have read sci-fi, you are probably already familiar with them. My thoughts I picked this up as an audiobook without knowing what I…
Here is a list of all the books I read in 2020, and a short summary of what I thought. Toward the end of the year, I started writing some longer summaries of the books including what I thought of them. AI Superpowers - Kai-Fu Lee 6 / 10 This is a good read. It is obviously biased toward China being the greatest place for businesses, but has interesting things to say.
Recommendation Overall, I would recommend this book to anyone who isn’t sure what they should be doing with their life. I like the techniques proposed in this book, but it feels like the authors are trying to sell me on something throughout the book, which was a bit off-putting. My Thoughts I recently spoke to a remote class of college students, and they were very concerned with how to find…
Recommendation I would recommend this book, but I think you might be able to get a similar amount of information by reading their blog posts. This book has a very useful mental model, and it has helped me identify and artculate things that I like and dislike about myself and other people. My thoughts Paradox 1 Time is one of the most powerful influences on our thoughts, feelings, and actions, yet…
Recommendation This was a good book. It’s a quick read, and I found it very enjoyable. I’m not sure how much of that was because I think it will be a useful book for others to read or if it was simply nice to read about someone that I seem to have so much in common with. My thoughts Similarly to Your Music and People, I was surprised to discover how short this book was, but it is…
Recommendation This book comes with my highest recommendation. It’s short, and every page packs a punch. Reading it will be a good use of your time. My thoughts Upon purchasing this book, I was a bit disappointed that it was so short. I felt a bit duped for spending $15 on the digital copy of a short book. I’m a big fan of Derek Sivers, and I’d picked up that he’s kind of…
Recommendation This was a good book. I’ve struggled to keep up a practice of meditation, but I find that breathwork is a good way to keep my meditation practice up. With breathwork I can strive for things like longer breath hold times, lower resting heart rate, and imrpoved cardio performance. I listened to this book as an audio book, and the appendix had some narrated breathing exercises.…
Book reviews I read and listen to a lot of books. Historically, I’ve just created a sentence or two after finishing the book or lecture series, but after reading the Mahabharata, I wanted a better format for discussing the books that I had been reading. Coincidentally, this was right around the time that I discovered Derek Sivers' book reviews; my book reviews are partially inspired by his…
Overview tldr; Generalists are useful for injecting energy I’ve recently moved from a large company (~1000 people) to a small company (<10 people), and it has given me a new perspective on the usefulness of generalists. I have spent most of my career working in small companies, and moving abruptly from the largest company I’ve worked for back to a small company has shed some light on…
How Remote work has affected me I’m writing this while lying on the living room floor with a pillow under me. This is a practice I developed while working through some chronic pain. I was unable to sit for long periods, and I didn’t have a standing desk (and standing doesn’t work as well as laying down for me). I find that it provides me with a nice, low intensity shoulder…
tl;dr Look for patterns in your past projects as guideposts for important decisions. Inspiration I was recently listening to the Capital Allocators Podcast, and someone finally put into words an idea that I’ve struggled to articulate - research graveyards. In a discussion about hiring quants, one of the things they look for is a “research graveyard”. The idea is that they want to…
Tl;dr I use obsidian for desktop, IA Writer for mobile, and keep everything in sync with Dropbox. Taking notes is hard During college, while I was freelancing, I developed a habit of taking notes. This has served me well since then, and I have tried to manage my notes in more ways than I can remember. The ones that I can remember trying are: Google Keep, Google Docs, Evernote, Jupyter notebooks,…
Overview Cells are just pockets of proteins in a bubble of fat. You may know fat by the way that it sticks to your pans after you’re done cooking. It’s the layer of grease that coats your cookware. Typically, you can’t just rinse the grease away, you need an agent that breaks up the grease. Broadly speaking, cells are made up of similar stuff to the grease that’s on your…
Overview Neurons are usually “grown” in two steps. First, they reproduce to become more cells. This is the intuitive meaning of cells growing (at least to me), and will be the subject of this post. Then, they are differentiated into the necessary neuronal cells that make up the culture. These are broadly divided into neural cells and glial cells. Neural cells These are the cells that…
Overview Let’s suppose you want to store cell lines for future use. The most obvious option would be to put them in an incubator and let them continue growing. But this would require some maintenance, and it’s pretty inconvenient if you want to do other things like move the cells. Another option might be to freeze them. But this has a pretty high liklihood of killing cells. When water…
Overview I’ve been learning about systems biology recently, and MAP Kinase seems to come up a lot. Systems biology is all about drawing maps between various biological processes like which genes create what proteins and how those proteins interact with each other. MAP kinase is often shown as an intermediary between various processes. MAP stands for Mitogen Activated Protein. This seems…
Overview Say you want to study a new drug, and you want to see if there are any interesting effects on human tissue. Maybe you’ve infected the tissue with a virus, and you want to see if the drug does what you think it does. It’s still early in the study, so you don’t want to give it to real humans yet. This is a very common practice, but it assumes that you can get tissue…
Overview I’ve been wondering about the differences between proteins and enzymes, and thought it would be good to start from first principles. In this post, I wanted to talk broadly about how proteins are made from DNA. Amino acids DNA is made of strings like GCCCGTAATAGTACATTACGA; This is translated in triplets into amino acids, and groups of amino acids produce proteins. So, if we grouped…
Overview The first word in “lac operon” refers to lactose, and the second word refers to the structure of the genes. Usually, when people discuss the lac operon, they do so in the context of e. coli. Though e. coli is not the only bacteria that can have the lac operon, it’s usually what people are referring to. I will continue that tradition. Lactose is a type of sugar often…
Introduction I was researching possible failure modes of plasmid transfection in e. coli, and I came across a post that mentioned DNA methylation as a possible problem. I had not dug into this before, and discovered that it is an entire field of study within biology. Before I realized how broad the topic was, I anticipated writing this blog post on DNA methylation; I then reduced its scope to only…
Which Coronavirus? There are many types of coronaviruses. Similarly to cancer, if we say “she is sick with coronavirus”, there are several questions that are left unanswered. If we were to say “she is sick with cancer”, we might follow up with “what kind of cancer?”. There are 7 known coronaviruses that infect humans Human coronavirus 229E (HCoV-229E) Human…
Overview Recently, I’ve been thinking it would be really cool to have a synthetic greenhouse; full of plants that could be found nowhere in nature. Flowers that glow in the dark, leaves that fluoresce under UV light, cucumbers that smell like vanilla, potatoes that taste like oranges. I’m getting a little ahead of myself, but it would be cool. This post will go over some techniques…
Overview Previously, I’ve talked about transfection of e. coli using heat shock in my post on plasmids. Transfection into single celled organisms can be relatively simple. Using heat and electricity, we can take an artificial plasmid and add it to e. coli or yeast. This synthetic addition to the DNA in a cell codes for a protein that we want, and the cell will now produce that protein like a…
Overview One project that I’ve had in the back of my mind is inventing new dyes based on colors in insects. Dyes created by biological mechanisms can be much more environmentally friendly than those created with chemicals. Unfortuantely, I have not found anywhere to buy the DNA that I want - in many cases, the genomes haven’t even been sequenced yet. Both of these problems will require…
Overview One of the driving factors behind the recent explosion in progress in synthetic biology has to do with the cost and speed of genome sequencing and synthesis. Here, I’m going to focus on genome sequencing. There are lots of companies that will do this for you, and lots of lab devices that you can buy so that you don’t have to do the sequencing yourself, but I thought it would…
Why do I care about this? In this post, I wanted to go over what bioinformatics does for synthetic biologists. I’m a software engineer by training, and I’ve even taken some of a bioinformatics course. But I still didn’t understand what the purpose of bioinformatics was. More importantly, I didn’t understand how what I do for a living now - AI - could help with it.…
What is a BAC? Previously, I wrote about plasmids as small, circular DNA sequences. The double edged sword of normal plasmids is that they are small. This can make them easier to reason about, but it can make them inconvenient for some uses. For example, if you wanted to study the herpes virus, it might be useful to have bacteria that carry the genome of the virus. BACs allow biologists to study…
What is this? This is a list of resources that I have found to be useful in my own exploration and learning. I will continue to update it based on what I use. Resources protocols.io - lots of open protocols openwetware - open protocols Benchling - Bunches of useful tools for labs bitesizebio - Lots of useful articles Thermo Fisher’s list of lab protocols diy-bio - Has tons of links, guides,…
What is a plasmid? Whenever I start looking into genes and genomes, I eventually end up at a circular diagram with highlighted sections with gene name labels. I understood that these represented genetic information, but I didn’t really understand why I should care about them. Being new at this whole biology thing forces me to remind myself of the fundamentals pretty often. In this case, I…
Why do synthetic biologists use PCR? One of the foundations of synthetic biology is being able to put new genes into organisms that did not previously have them. Unfortunately, genes don’t naturally come in buckets of purified DNA segments; we have to make those ourselves. And this is where PCR comes in. If you happened to find a really cool jelly fish that glowed under UV light, you…
Back when I was first starting on my adventures in software, there was so much to learn. Even with the copious resources available, I still found it difficult to wrap my head around concepts that people were writing about. I felt like if someone could frame the problem for me correctly - and sometimes someone would - then I would have been able to learn things much faster. This will be a blog…
My name is Peter Klipfel, and I have many interests. I currently love my work at Mantium where I am helping people use cutting edge AI safely and effectively. When I’m not at work, I enjoy: Microbiology and biotechnology Making music (piano and Ableton) A select few video games Climbing Riding my motorcycle - specifically adventure riding Anything involving snow If any of these things…