RSS Amplifier

The Virology Controls Studies Project · May 29, 2026

THE EBOLA HOAX

0
Sign in to vote or save

Jamie Andrews · The Virology Controls Studies Project

The Annual Subscription is being kept at the incredibly low price of just $35. I sell no bullshit supplements, no crappy merchandise, no whacko gadgets, I have no sponsors, no advertising and everything is possible to read for free. However to help in running the experiments and to cover the huge costs that are mounting from travel and expenses to operate the project, please consider donating to the largest Crowdsourced and Opensourced experiments falsifying Virology. Thank you.

This fake “virus” is an absolute firm favorite of the wibbles on the internet who have an enduring infatuation with the Germ Theory. If you don’t know the type by now, I will share my near daily experience of dealing with these bottom feeders for now more than half a decade (genuinely feels like only yesterday right? ).

The story goes a little like this: I put out a piece of peer reviewed science that completely contradicts the narrative of some part of the Germ Theory or Genetics. Germ Theory Enthusiast arrives on the scene at an inhumanely quick pace and either has a completely unprovable anecdote fitting the exact method that contradicts the science I presented OR jumps straight into death threat mode: “If germs aren’t real then why don’t you inject yourself with Ebola? Hahaha”. The Ebola part to that is where these agent provocateurs think they have been really smart, as people might agree to a bought of da “Flu” but nobody in their right mind would “risk” it with bleeding out the eyes with “Ebola”. It serves as the biggest scariest monster under the bed, the Top Trump on the list of Boogiemen to play when making their online threats.

Just to make this public for people whom have encountered this online, I will point out that this is a threat and is considered a serious crime in the US and EU. A person making a bet or encouraging people to inject themselves with what they believe will kill or seriously injure someone is a direct intent to encourage suicide or serious harm and carries a prison sentence of up to 10 years. So these trolls that think they are being funny or proving a point are actually committing a crime and will be reported for doing as such.

I don’t really need to explain myself, but I will anyway, the reasons why I won’t be partaking in any injections, of anything:

A. To prove or disprove Contagion you have to use a method that is a claimed natural pathway, there is no natural pathway that comes from a hypodermic needle being thrust intravenously.

B. These Contagion studies have been done for 200 years, experimenting with all of these claimed “viruses” and have never managed to make anyone sick with the claimed disease caused, all documented for anyone to read.

C. Injecting anything, even saline comes with its own set of hazards, and can actually induce cold and flu like symptoms as seen in many control groups in contagion studies and outlined experimentally below. The body is not used to having anything directly entering the bloodstream before it has been digested, broken down and filtered first. “Chemically” it is going from 0-100 almost instantaneously which is why it is the ultimate hit for drug abusers and usually ends fairly quickly once this stage of abuse is reached (The ultimate way to throw your body out of balance).

D. In the claimed “viral” isolates are plenty of noxious chemicals especially in the antibiotics area. Listed below are all of the ingredients in the cell culture, only 5/23 ingredients not being considered toxic to humans. Once again, injecting any of these things comes with potential harms.

  • Water

  • Sodium chloride (NaCl) — generally safe at culture concentrations

  • Potassium chloride (KCl) — harmful in high doses

  • Calcium chloride (CaCl₂) — irritant in concentrated form

  • Magnesium sulfate (MgSO₄) — low toxicity

  • Sodium bicarbonate (NaHCO₃) — low toxicity

  • Sodium phosphate (NaH₂PO₄) — low toxicity

  • Glucose (D-glucose) — safe nutrient

  • Sodium pyruvate — low toxicity

  • HEPES buffer — low toxicity, lab irritant possible

  • Phenol red — possible endocrine activity in some studies; irritant in concentrated form

  • L-glutamine — low toxicity

  • Essential amino acids (lysine, leucine, valine, tryptophan, etc.) — generally safe nutrients

  • Non-essential amino acids (serine, glycine, alanine, etc.) — generally safe

  • Vitamins (thiamine, riboflavin, folic acid, niacinamide, choline, inositol, etc.) — generally safe at culture concentrations

  • Trace iron/nitrates — irritant/toxic at high concentrations

  • Fetal bovine serum (FBS) — biological material; contamination/allergy/infectious-agent risk possible

  • Penicillin — allergy risk in humans

  • Streptomycin — ototoxic/nephrotoxic at systemic doses

  • Amphotericin B — significantly toxic systemically

  • Gentamicin — nephrotoxic/ototoxic

  • Trypsin-EDTA (used during passaging) — corrosive/irritant to tissue

  • Antibiotic-antimycotic mixes — variable toxicity depending on components

E. Just viscerally I do not inject things into my body. Even if nobody had ever come to any harm from injection and you could somehow prove it, injecting stuff into ones body is for junkies, tramps, degenerates and people who believe in “Viruses” (Same thing alert). In the animal kingdom, injection through breaking the flesh is ONLY done by things looking to do harm, or seriously deter such as snakes, spiders, scorpions etc etc. They do this, as above, because their venom has the most possible chance of doing damage which is why such tiny creatures with such small amounts of poison can be so injurious to animals much bigger.

They distilled water, i.e made it completely sterile and with its injection produced fever and cold like symptoms in rabbits. But then somehow concluded that despite being distilled, still contained a pathogenic agent. Germ Theory Idiocy strikes once again.

Sorry for that little detour, I think some of those things had to be put in an article at some point and was feeling a little zesty. Back to the millstone:

The first thing I want to point out is quite esoteric, it is not something that I really want to descend too far down the road with “evidence” based reasoning as largely it meanders down the wormhole of GeNEtICs and PrOtEOmIcs which in totality is a made up fairytale, so it would be extremely tedious. But one thing that is very apparent to me is that the claim is there are 1.67m distinct species of “virus” (Lol) and they range from being claimed to be endogenous to humans (I.e present at all times in our “genome”) right the way through to piss out your kidney and bleed out your ears in under 24 hrs with Ebola and everything in between.

The length of the claimed Viral Genomes which is all a “virus” is, a claimed string of 4 different nucleotides varies from around 1kb to 2.5mb whereby the length of the genome has absolutely nothing to do with its claimed pathogenicity. They claim that only small sections of these (genes) which code for “proteins” actually carry out the pathogenicity. This “pathogenicity” as we have seen ranges from nothing to dead in days, so really what they are claiming is that depending on what order you write 4 letters depends on whether you live or die…..

atcgtgtattatgcggcgatcgtacggtatg : That one is fine, that encodes for a “protein” that just does nothing.

ctactacggatgtttagaccaacgtcattcgc: That one encodes for a “protein” that liquifies your liver.

As I say I will spare you the magic roundabout that any investigation goes on in this area because all of the Science is based purely on a “trust me bro” basis. When it comes to pathogenicity they push everything into the realms of proteomics where it is just harmless or deadly, once again going down some rabbit hole of molecular chemistry with zero explanation or evidence about how or why it happens other than “it does happen” and we invented a story to fill in the gaps.

So my overarching point is the absurdity of claiming that the way 4 different claimed molecules are “ordered” is literally life or death, this should go to the same thinking as “genetic” and “Oncological” diseases and the general notion that the human body can and will attack itself. One of the most absurd lies in medical “science” that all of a sudden for no particular reason your insides just decide to kill themselves and take you with them. It is clear that this kind of thinking is just more of an insurance policy for industrial and medical harms.

Yes — and very overwhelmingly so. Nearly all recorded deaths from Ebola virus disease have occurred in Africa.

Here’s a concise breakdown by major outbreaks and countries over time (rounded figures):

  • Democratic Republic of the Congo (then Zaire)

    • ~280 deaths (1976 outbreak)

  • Sudan

    • ~150 deaths (1976 outbreak)

👉 Early outbreaks already concentrated in Central/East Africa

  • Uganda

    • ~224 deaths (2000 outbreak)

  • Republic of the Congo

    • ~200+ deaths across multiple outbreaks

  • Gabon

    • ~150+ deaths

👉 Still entirely African, mostly Central Africa

West Africa epidemic:

  • Liberia

    • ~4,800 deaths

  • Sierra Leone

    • ~4,000 deaths

  • Guinea

    • ~2,500 deaths

Total: ~11,300 deaths

👉 This single epidemic accounts for most Ebola deaths in history

  • Democratic Republic of the Congo

    • ~2,300 deaths

  • DRC, Uganda, Guinea

    • Typically tens to hundreds of deaths per outbreak

  • A few isolated cases in:

    • United States

    • Spain

  • Deaths outside Africa: extremely few (single digits)

  • Total Ebola deaths (all time): ~15,000+

  • In Africa: >99.9%

  • Outside Africa: negligible

👉 Ebola is almost entirely geographically confined to Africa, both in outbreaks and deaths, with the 2014–2016 West Africa epidemic dominating the global total.

The reason almost all deaths from Ebola virus disease occur in Africa isn’t one single factor—it’s a combination of ecology, exposure, and public health response.

  • Ebola is believed to be maintained in fruit bats (especially African species)

  • These animals live in Central and West Africa, so spillover events start there

👉 No reservoir elsewhere → no sustained outbreaks elsewhere

Fruit bats (family Pteropodidae, often called flying foxes) are actually widespread across the tropics, not just Africa.

  • Europe (native populations absent)

  • Most of North America

  • Most of South America

👉 These regions have bats, but not fruit bats (Pteropodidae)

Fruit bats live across Africa, Asia, and Oceania, meaning:

  • The presence of these animals alone does not explain Ebola outbreaks

  • Other ecological and epidemiological factors matter too

Really we don’t need to go much further with our investigation here. In totality even the mainstream admit that it is the Terrain that makes the disease. Ebola is ONLY found in Africa, they claim it comes from a Fruit bat and people eating bushmeat, i.e eating bats (where have we seen that one before lol ). Yet Fruit bats are native to everywhere else in the entire world apart from Europe and the Americas. Once again, to point this out they claim that eating bat soup in Wuhan gives you a runny nose, but eating a bat in Uganda dissolves your kidneys. They strangely regard eating Fruit bat as a traditional delicacy in Samoa and Papua New Guinea. Just by sheer logic, if eating these things did make some tribes people (but not all obviously PMSL) piss out their kidneys and bleed out their eyes, one would have thought that they might have replaced the “Christmas bat” with something slightly less dangerous. So logic dictates that the “zoonotic” theory is bunkum obviously and everything points to this being a geographical problem specific to Africa.

Ebola (various species like Zaire/EBOV, Sudan/SUDV, Bundibugyo/BDBV, and Taï Forest) has primarily affected Central and West Africa since 1976, with most cases in forested or rural areas linked to wildlife (e.g., fruit bats). Key countries with local/autochthonous outbreaks or transmission include:

en.wikipedia.org

  • Democratic Republic of the Congo (DRC): Multiple outbreaks; heavily affected.

  • Guinea, Liberia, Sierra Leone: Major 2014–2016 West Africa outbreak.

  • Uganda: Several outbreaks.

  • Gabon, Republic of the Congo: Multiple.

  • South Sudan (formerly Sudan): Early outbreaks.

  • Ivory Coast (Côte d’Ivoire): Taï Forest virus case.

  • Others with smaller/local transmission: Nigeria, Mali, Senegal, South Africa.

Imported or limited cases (often single patients or short chains, no sustained outbreak) occurred in: Italy, Spain, UK, US, Philippines, Russia, and others.

mercycorps.org

Mining Activities in These CountriesVirtually all African countries with local Ebola transmission have active or historical mining (industrial, artisanal/small-scale). Africa is rich in minerals, and many Ebola-affected areas overlap with mining zones (e.g., gold, diamonds, iron ore).

en.wikipedia.org

  • DRC: Major global producer of cobalt, copper, diamonds, gold; outbreaks have occurred in/near mining areas (e.g., gold mining villages).

    abcnews.com

  • Guinea, Liberia, Sierra Leone: Significant iron ore, gold, diamonds, bauxite; mining was impacted but continued during the 2014–2016 outbreak.

    pmc.ncbi.nlm.nih.gov

  • Gabon, Republic of the Congo: Oil, manganese, gold, timber-related extraction; historical gold-mining camp outbreaks.

    en.wikipedia.org

  • Uganda: Gold, copper, and other minerals; artisanal mining present.

  • South Sudan: Gold, copper, iron ore, limestone; artisanal gold mining is active and economically important.

    en.wikipedia.org

  • Ivory Coast: Gold (major producer), diamonds, manganese, bauxite, nickel; growing formal and informal sector.

    en.wikipedia.org

  • Mali, Nigeria, Senegal: Gold (Mali is a top African producer), plus other minerals.

Here we see that every single place that has experienced an “Ebola” outbreak is also an area of heavy mining and exploitation of raw earth materials. Africa has throughout the 19th and 20th Centuries been the playground of the Colonialists looking to exploit the locals for slave labor and the land for its natural resources, take back as plunder to the West. I want to chose the country in the news as the latest “Ebola” outbreak to focus in on just so we don’t spread ourselves too thinly and can deeply analyze it, being the Democratic Republic of the Congo ( sounds very official doesn’t it). We will see later on that the exploits of the colonizers has never really ceased, they just do it remotely now.

The reign of Leopold II of Belgium in Central Africa (roughly 1885–1908) is widely regarded as one of the most brutal colonial regimes in history.

Leopold didn’t rule the Congo as a Belgian colony at first—he personally owned it as the Congo Free State, established after the Berlin Conference. He presented his rule as humanitarian and anti-slavery, but in reality it became a system of extreme exploitation.

The main goal was profit, especially from rubber and ivory. To maximize extraction, Leopold’s agents imposed strict quotas on Congolese villages. If people failed to meet them, they faced horrific punishments: beatings, hostage-taking, mutilation (most notoriously cutting off hands), and execution. These acts were often carried out by a colonial army called the Force Publique.

The human toll was staggering. While exact numbers are debated, historians estimate that millions of Congolese people died due to violence, forced labor, starvation, and disease during Leopold’s rule.

International outrage grew in the early 1900s, fueled by activists like E. D. Morel and Roger Casement, who exposed the abuses. Under mounting pressure, Leopold was forced in 1908 to hand control of the territory to the Belgian government, ending his personal rule.

In short: Leopold II’s Congo regime was built on forced labor, terror, and mass death—leaving a legacy that still shapes perceptions of colonialism today.

Smartphones, computers and electric vehicles may be emblems of the modern world, but, says Siddharth Kara, their rechargeable batteries are frequently powered by cobalt mined by workers laboring in slave-like conditions in the Democratic Republic of Congo.

Kara, a fellow at Harvard’s T.H. Chan School of Public Health and at the Kennedy School, has been researching modern-day slavery, human trafficking and child labor for two decades. He says that although the DRC has more cobalt reserves than the rest of the planet combined, there’s no such thing as a “clean” supply chain of cobalt from the country. In his new book, Cobalt Red, Kara writes that much of the DRC’s cobalt is being extracted by so-called “artisanal” miners — freelance workers who do extremely dangerous labor for the equivalent of just a few dollars a day.

“You have to imagine walking around some of these mining areas and dialing back our clock centuries,” Kara says. “People are working in subhuman, grinding, degrading conditions. They use pickaxes, shovels, stretches of rebar to hack and scrounge at the earth in trenches and pits and tunnels to gather cobalt and feed it up the formal supply chain.”

Kara says the mining industry has ravaged the landscape of the DRC. Millions of trees have been cut down, the air around mines is hazy with dust and grit, and the water has been contaminated with toxic effluents from the mining processing. What’s more, he says, “Cobalt is toxic to touch and breathe — and there are hundreds of thousands of poor Congolese people touching and breathing it day in and day out. Young mothers with babies strapped to their backs, all breathing in this toxic cobalt dust.”

Cobalt is used in the manufacture of almost all lithium ion rechargeable batteries used in the world today. And while those outside of the DRC differentiate between cobalt extracted by the country’s high-tech industrial mining companies and that which was dug by artisanal miners, Kara says the two are fundamentally intertwined.

“There’s complete cross-contamination between industrial excavator-derived cobalt and cobalt dug by women and children with their bare hands,” he says. “Industrial mines, almost all of them, have artisanal miners working, digging in and around them, feeding cobalt into the formal supply chain.”

Sponsor Message

Kara acknowledges the important role cobalt plays in tech devices and in the transition to sustainable energy sources. Rather than renouncing cobalt entirely, he says people should focus on fixing the supply chain.

“We shouldn’t be transitioning to the use of electric vehicles at the cost of the people and environment of one of the most downtrodden and impoverished corners of the world,” he says. “The bottom of the supply chain, where almost all the world’s cobalt is coming from, is a horror show.”

Some 20,000 people work at Shabara artisanal mine in the DRC, in shifts of 5,000 at a time. The DRC produced approximately 74% of the world’s cobalt in 2021.

Junior Kannah/AFP via Getty Images

Technically, under the law, there should not be artisanal mining taking place in any industrial mine. And yet, lo and behold, at most of the industrial mines, there is some artisanal mining taking place. In some cases, predominantly artisanal mining is taking place. And the reason is, it’s a penny-wage way to boost production. I mean, imagine you’re in a part of the world where there are millions of people who barely get a dollar or two a day who are grindingly poor and will accept almost any labor arrangement just to survive. Well, you put them in a tight pit, cram them with 10,000 other people and pay them a couple of dollars, and they’ll produce thousands of tons of cobalt per year for almost no wages. And so that’s not legal, but it’s happening.

Imagine an entire population of people who cannot survive without scrounging in hazardous conditions for a dollar or two a day. There is no alternative there. The mines have taken over everything.

Siddharth Kara

Imagine an entire population of people who cannot survive without scrounging in hazardous conditions for a dollar or two a day. There is no alternative there. The mines have taken over everything. Hundreds of thousands of people have been displaced because their villages were just bulldozed over to make place for large mining concessions. So you have people with no alternative, no other source of income, no livelihood. Now, add to that the menace in many cases of armed forces pressuring people to dig, parents having to make a painful decision, ‘Do I send my child to school or do we eat today?’ And if they choose the latter, that means bringing all their kids into these toxic pits to dig just to earn that extra fifty cents or a dollar a day, that could mean the difference between eating or not. So in the 21st century, this is modern-day slavery. It’s not chattel slavery from the 18th century where you can buy and trade people and own title over a person like property. But the level of degradation, the level of exploitation is on par with old-world slavery.

An artisanal miner holds a cobalt stone at the Shabara artisanal mine in the DRC.

Junior Kahhah/AFP via Getty Images

Imagine a mountain of gravel and stone just avalanching down on people, crushing legs and arms, spines. I met people whose legs had been amputated, who had metal bars in where their legs used to be.

Siddharth Kara

I spoke with many families whose children, husbands, spouses, had suffered horrific injuries. Oftentimes, digging in these larger open-air pits, there are pit wall collapses. Imagine a mountain of gravel and stone just avalanching down on people, crushing legs and arms, spines. I met people whose legs had been amputated, who had metal bars in where their legs used to be. And then the worst of all is what happens in tunnel digging. There are probably 10,000 to 15,000 tunnels that are dug by hand by artisanal miners. None of them have supports, ventilation shafts, rock bolts, anything like that. And these tunnels collapse all the time, burying alive everyone who is down there, including children. It's a demise that is almost impossibly horrific to imagine. And yet I met mothers pounding their chests in grief, talking about their children who had been buried alive in a tunnel collapse. And these stories never get out of the Congo. People just don't know what's happening down there.

Sponsor Message

MacMillan

There's money to be made in every corner and every direction. And you've got these militias. Sometimes they're called commandos and they will abduct children, traffic children, recruit children from even other parts of the Congo. I met children who had come from hundreds of miles away and have been brought through militia networks down into the copper cobalt mines to dig. And as they dig and earn their dollar or two, that's what funds these militia groups. So children are the most heavily exploited of all the people down there. They're the most vulnerable and oftentimes trafficked and exploited in some cases in very violent circumstances.

Corruption is a big part of the problem. That's what allows so much of this abuse to persist. And the thing is, imagine the Congo. It's a war-torn, deeply impoverished nation that has been subjected to generations of pillage and ransacking going all the way back, now centuries, to the slave trade. And so when big foreign stakeholders come waving around large sums of money, it's not a long stretch of the imagination to see that there would be corruption. ...

The first democratically elected president of the Congo [in 1960], Patrice Lumumba, made a pledge that the country's immense mineral riches and resources would be used for the benefit of the people who live there. And in short order, within six months, he had been deposed, assassinated, chopped to pieces, dissolved in acid and replaced with a bloody dictator, a corrupt dictator who would keep the minerals flowing in the right direction. So if you don't play ball with the power brokers at the top of the chain and with the Global North, Patrice Lumumba showed what's the outcome, what will happen. And I think that's also a part of this lesson that we need to understand historically, when we talk about things like corruption.

China cornered the global cobalt market before anyone knew what was happening. It goes back to the year 2009 under the previous president in the Congo,

You know how they like to leave their calling card with these hoaxes, well this one is really quite in your face. Outlined above is the appalling slavery of past and present that is quite obviously hazardous to human life, endangering the men, women and children forced either directly or indirectly ( because globalist corporations have mechanized the process elsewhere pushing more artisanal mining to occur to be able to keep up with the wealth disparity of inevitable inflation).

One thing that none of the news articles really seem to touch upon is the massive release of naturally occurring toxins, poisons and heavy metals released into the environment, waterways and air but also the vast amount of toxic chemicals that are used in the mining process itself. One of those that is very frequently occurring is Arsenic, which just so happens to be atomic number 33, the 33rd element in the periodic table (Huge Eye Roll). It is going to be the element we focus in on in this article, but for sake of clarity there are MANY MANY others involved and released in the mining activates including mercury, lead, manganese and cyanide.

6

These are often locked in rock and become dangerous when mining exposes and processes them:

  • Arsenic

  • Lead

  • Mercury

  • Cadmium

  • Chromium (especially toxic Cr(VI))

  • Nickel

  • Copper (toxic at high levels)

  • Cobalt (can cause lung/heart issues)

  • Manganese (neurological toxicity)

  • Uranium

  • Thorium

When exposed to air and water, these can form acid mine drainage and leach into rivers, soil, and drinking water.

4

  • Sodium cyanide

  • Potassium cyanide
    👉 Used in cyanide leaching to dissolve gold

  • Mercury
    👉 Used in artisanal mining to form gold amalgam (very dangerous)

  • Sulfuric acid

  • Nitric acid

  • Hydrochloric acid
    👉 Used in refining and ore treatment

  • Lime (to control pH, but still reactive)

6

Cobalt is usually extracted alongside copper using hydrometallurgy:

  • Sulfuric acid (the most common)

  • Organic solvents (e.g., kerosene-based mixtures)

  • Phosphoric acid derivatives (to separate metals)

  • Ammonia

  • Sodium hydroxide

  • Hydrogen peroxide

These help dissolve, separate, and purify cobalt and copper.

Even if not directly added, mining generates dangerous substances:

  • Forms when sulfide minerals react with air + water

  • Produces sulfuric acid + dissolved metals

  • Sulfur dioxide

  • Hydrogen sulfide

  • Silica dust (causes lung disease)

  • Metal-laden dust (cobalt, uranium, etc.)

As explained above, one of the elements regularly released in all of the different mining activities both artisanal and industrial is Arsenic. Not only direct poisoning but much worse it waterway and air contamination. Now we should all be very aware having heard of Arsenic as being used as one of the most prevalent poisons for thousands of years:

Arsenic has been used as a poison for thousands of years, and it’s one of the most infamous poisons in history.

Arsenic became a “classic” poison because:

  • Colorless, tasteless, and odorless (in common forms like arsenic trioxide)

  • Easy to mix into food or drink

  • Causes symptoms (vomiting, diarrhea) that used to look like natural illness

  • Widely available historically in medicines, pesticides, and pigments

  • Known in ancient Greece and Rome

  • The Roman writer Pliny the Elder described arsenic compounds

  • Poisoning was already associated with political intrigue

  • Became notorious among elites and nobility

  • Sometimes called “inheritance powder” because it was used to eliminate rivals or family members

  • Associated with famous poisoning cases (e.g., the Borgia family—though some stories are exaggerated)

  • Arsenic poisoning became extremely common

  • Sold openly as rat poison and even used in cosmetics and medicines

  • Earned the nickname “the king of poisons”.

So I mean call me a conspiracy theorist and stuff but I just thought I’d have a look at what the symptomology of Arsenic Poisoning was and compare it side by side with that of claimed “Ebola”, largely as outlined at the very start of this article that it just isn’t very plausible that some “viruses” do nothing then all of a sudden some just melt your face off. Just to really ram home the point I made a little infographic about it:

So interestingly enough, Arsenic poisoning happens to share absolutely identical symptomology with claimed “Ebola” (this gets better). I then made an infographic of the latest hotspots and cases of the 2026 “Outbreak” in DR Congo and laid it over a picture of known high Arsenic contamination levels in mining areas and waterway channels connected to them.

Would you know it that they neatly line up in these areas. Further to this it is well documented that many clusters of these come directly from mine workers themselves, as well as many other African countries that have supposedly experienced these “Outbreaks”.

We’ve kind of worked backwards in this article, usually we start with the smallest thing first (The non existent entity), work through its lack of contagion then finally onto the plausible substitutes for what is actually causing the blamed disease, if applicable. With Ebola, because of the so very obvious localized Terrain that this occurs in and with a culprit so bang on, I thought I would start with all of that evidence and leave the ridiculousness to the end. Really the Virological part to the “Ebola” hoax is so laughable it hurts, especially for the actual particle they claim it is.

First on the chopping board is claimed contagion. Obviously the “ethics” committee is in full flow on this one, because the gasping and shock horror sounds when you suggest that they provide you any evidence of human transmission that wasn’t don’t with Kary Mullis’ flashing fraud box. “No!” they proclaim “Why everyone would die! if we infected them with Ebola!!”. Again these torture junkies are salivating at the bit to kill lots of animals though aren’t they, so let’s have a look at when they gave what they consider to be purified “Kidney Melter” to a bunch of Rhesus Monkeys:

That’s right, shortly before Euthanizing them (once again the Ethics committee- the HR of the clinical trials world, weigh in on this one to cover up the failure) they logged the symptoms of these monkeys and the only thing they managed to track was a lack of biscuit consumption. I mean call me a skeptic but if you were trapped in a cage, held down and injected with shit and then saw all of your mates being taken away one by one, it might put you off your digestives a bit. But needless to say, not even a snifter of melted kidneys were seen in these symptom sets, as usual they kill the monkeys, dissect them and point at different color of the brutalized body parts they have brutalized with their dissection.

From the Published, Peer Reviewed Journal of Virology images of claimed Ebola Virus in Vero Cells:

Source 2: Claimed Zaire Ebola on Research Gate

Source 3: Claimed Human Cell Expressing Ebola Protein with Ebola Virions visible

Source 4:

Demonstrated in the clear images cross referenced that the particles that are being labelled as Ebola Virus are strands of Filopodia, the spacing where they intersect the 2d plain of the TEM slice some cross sectional, some longitudinal showing protrusions is identical in infected and uninfected. The American Society For MicroBiology even uses Vero cells to claim to show Ebola Virions, a cell that is well known to have plenty of Filopodia as shown in our uninfected culture TEM.

Thank you to Marvin Haberland and NEXT Level for pointing this ridiculously funny cell culture self own. In this paper it is about “Ebola” which is why I will include it here in this article, however it really isn’t anything specific rather than falsifying the Cell Culture Isolation Technique (Once again- as if it wasn’t already lying in tatters on the floor.

The matrix effect (cytotoxicity) of normal breast milk and semen was tested in MDM, Vero E6, and Huh-7 cells. Breast milk or semen, whether whole or clarified by centrifugation, were added to 90% confluent monolayers of each of the three cell types. A control flask with only media was incubated in parallel. Cell monolayers were photographed at days 0 (after 1-h incubation), 3, 7, and 10 post-exposure (not all images shown, Figure 5). Breast milk was cytotoxic on Vero E6 and MDM cells at volumes of 50 and 100 µL. However, breast milk visually appears less toxic in Huh-7 cells. Toxicity was initially identified (day 0 post-exposure) in the 100-µL treatment, and the cell monolayer recovered by day 10 post-exposure. Breast milk that was clarified by centrifugation was not toxic at the concentrations tested. Whole semen and semen clarified by centrifugation were both slightly cytotoxic in MDM cells but not Vero E6 or Huh-7 cells (Table 3). Images of cell monolayers at ten days following semen or breast milk exposure are displayed (Figure 5).

Figure 5. 10× images of MDM, Vero E6, and Huh-7 cells taken 10 days following exposure to select volumes of normal semen, breast milk, or cell culture media (control). Breast milk was toxic at 50 and 100 µL/T-25 flask on Vero E6 cells (no cells present after 10 days) and MDM cells, but toxicity was less on these cells than on Huh7 cells.

Additionally, two litters of suckling laboratory mice were injected IC with 10 µL of breast milk, semen, or cell culture media. No laboratory mice experienced fatality during the 10 days after injection (Table 3). Two animals exposed to semen did not recover from anesthesia and were not counted against the number of survivors.

To determine if matrix effect impacts virus isolation success, spiked semen and breast milk were inoculated onto VeroE6, Huh-7, or MDM cells as described above. Results were compared to media only preparations using the log binomial likelihood ratio statistic and compared to the chi-squared reference distribution with significance considered at the 0.05 level. Again, there was no statistical difference in isolation success for spiked media samples across cell types. VeroE6 and Huh-7 cells were both successful at isolating virus at the same dilutions (p = 0.96) and both demonstrated significantly better virus isolation success from spiked semen samples than MDM cells (p < 0.01). Virus was not isolated from any of the spiked breast milk samples even though the cell monolayers appeared healthy. Isolation success from spiked semen or media were not significantly different by across the cell types (Table 4).

Table 4. Virus isolation success from spiked breast milk and semen samples (n = 12).

Potential semen- or breast milk-associated matrix toxicity was also assessed for these same methods. Huh-7 cells and brains of suckling BALB/c laboratory mice were the most resistant to breast milk-associated matrix toxicity. Interestingly, concentrations of breast milk that were shown to be toxic when unaltered were not toxic following clarification by centrifugation. This suggests the matrix cytotoxicity of breast milk is most likely related to components of the sample that were centrifuged out. Whole semen and semen clarified by centrifugation were both slightly cytotoxic in MDM cells but not Vero E6 or Huh-7 cells, suggesting the cytotoxicity is related to soluble matrix components that were not removed by the centrifugation process. Though the normal semen and breast milk used in this study were from individual healthy donors, it is unknown how much matrix toxicity would vary between donors or health status. Virus isolation was not successful from spiked breast milk and the mechanism of virus replication inhibition is unknown. The isolation attempts were made by two different users on two separate days in parallel with the isolation spiked semen or media control. If virus isolation from breast milk samples will be pursued in the future, altenative isolation methods will need to be identified. Additionally, although components of semen have been reported to increase EBOV infection in HeLa cells, in the present study virus isolation from spiked whole semen was as sensitive as the media matrix samples. The difference in results from these two studies may be explained by the use of whole semen instead of seminal plasma or components of semen as well as a differences in the in vitro effects of these matrices on the cell lines used

Why they decided to put breast milk into a cell culture is unclear, but I am very grateful they did as it sets up one of the most comedy falsifications in Virology. They note that in all cases uninfected breast milk put in as a sample to a Cell Culture produces CPE. This is again the same in most cases when they put uninfected semen in too (Don’t ask). Strangely after this they decided to spike in some “ebola” into the milk and cum and try and culture it. Even more strangely despite milk creating the CPE on its own, when combined with “Ebola” it then somehow undid the CPE.

What I believe is happening is that given these two fluids have a very different ionic balance for their very different roles, in the uninfected cultures they are not providing extra nutrients to the assumed reduced FBS (They don’t list a proper method- surprised, not). The cells go into starvation and produce the CPE. When they are coming to the “neutralizing matrix” with spike ins, they readily admit they compare them to the baseline they had (Which IS surprising, as benchmarking is a rarity in soyence). Potentially active semen would reduce the nutrients and cause extra CPE, the breast milk not and the addition of the spike in provided enough serum to keep the CPE observed the same. This invokes the John Enders “the samples both show CPE but look different” thing again.

They even carried out a control infection with the uninfected breast milk and semen and injected it into their newborn mice (Sick psychopaths). They proudly proclaim that the newborn mice survived the 10 day period they gave them to live claiming it was a “successful” control. Except when you read the fine print, 2 of the mice actually died, they just didn’t count them because apparently they died too soon SMH.

Whenever there are extreme claims of things happening within the reams of FakeVirusology it pleases me greatly. With the nothing burger ones like Sars Cov 2, Influenza etc the ground data so so easily obscured. With symptoms, even when claimed “symptomatic” they can be ridiculous things like a blocked nose (anosmia), coughing or a headache. Of course these things are just everyday occurrences, you can blame patterns of these things on practically anything and you would find some statistical significance. But here, right at the other end of the spectrum, is Ebola and Hantavirus, get some rat piss in your chicken curry on a cruise or get a dodgy bat burger whilst trekking through the Congolese rainforest and wham you are a goner. There is no leeway, no matter how much they kick and scream with these fake viruses.

It rules out the PCR/ Asymptomatic claim for even being too much of a clownmaxxing posture for the hoax perpetrators to pull off. Extraordinary claims require extraordinary evidence and so this wheelhouse of apocalyptic invisible bugs really does need some solid death stats when they are injecting animals with it. So when they are injecting it with syringes full of the stuff and instead of them pissing blood out their eyes they are measuring biscuit consumption we should be able to call hoax just on that one metric alone.

Really we should be able to call foul on the whole thing from, just the plain old illogical nature of the Germ Theory. If a contagious disease with a 40% death rate that causes you to piss the infected blood everywhere (like the MOVIE 28 days later) then humanity would have been wiped out many millennia ago, indeed there would be no life on earth, presumably apart from Ebola and the Rat Piss virus, just hanging out at a Club Med talking about the good old days when they had a host to infect.

For me personally the actual particle they claim is an “Ebola” virus is so funny. It is like they really went out of their way for the Hollywood props department to not choose the standard blob they find in the cell culture, no it is giving “Snakes on a Plane” vibes with this one, the serpent, the parasite feel to it. When I had a look at these cells under a Transmission electron microscope it was so comedically obvious, the filopodia, the hair like structures that a cell grows when stressed to become motile are being falsely labelled as “Ebola”. The fact that they always point to claimed Ebola right outside the cell exactly where these filopodia are usually located. The whole thing is absurd.

We saw how a long history of slavery by these demonic people forces innocent people to endanger their lives on a daily basis, how these mining activities, ironically for the Green Agenda are polluting the air, water and soil with incredibly toxic poisons and heavy metals that cause these exact extreme symptoms blamed on the non existent pathogen. Arsenic has the absolute identical profile for being the actual murder culprit whenever the extreme symptoms are seen. As with all these hoaxes I would still not want to say “All deaths blamed on Ebola are Arsenic Poisoning”, when it comes to health and hoaxes there are infinite variables at play. Firstly only 16k people have ever claimed died from Ebola in history, which is relatively miniscule especially in countries such as Uganda that have been home to many admitted Genocides.

So when analyzing these things, firstly has it happened at all? With only 16k in history we can be sure that the vast majority of those would not have the exact eye bleeding kidney melting hemorrhagic fever as described, if indeed they have died in anything other than by a Machete wielding Genocidal Maniac Politician and their henchmen. We then can move on and say, OK there are a few thousand dying in this hemorrhagic fashion but it might not all be because of Arsenic, the patterns might not match up. Well there is a raft of other natural earth poisons and heavy metals in these areas; mercury, lead, cyanide etc… it could always be a nice little cocktail. Any which way I hope you can see the very plausible nature of being able to explain violent symptomatic deaths like Hemorrhagic fever much much better with chemical/elemental poisoning.

If you have enjoyed this article and want to support the project with a one time donation please BuyMeACoffee, thanks!

This article is available as a downloadable EBook along with the rest of my work on ShadowBanned Library

No posts

Read the original on controlstudies.substack.com

Comments

Nothing yet. Say the first thing.

    Sign in to join the conversation.