PubMed Central (PMC)

Abstract

We have analyzed 247 Brazilian mtDNAs for hypervariable segment (HVS)–I and selected restriction fragment-length–polymorphism sites, to assess their ancestry in different continents. The total sample showed nearly equal amounts of Native American, African, and European matrilineal genetic contribution but with regional differences within Brazil. The mtDNA pool of present-day Brazilians clearly reflects the imprints of the early Portuguese colonization process (involving directional mating), as well as the recent immigrant waves (from Europe) of the last century. The subset of 99 mtDNAs from the southeastern region encompasses nearly all mtDNA haplogroups observed in the total Brazilian sample; for this regional subset, HVS-II was analyzed, providing, in particular, some novel details of the African mtDNA phylogeny.

Introduction

Brazilians form one of the most heterogeneous populations in the world, the result of 5 centuries of interethnic crosses between peoples from three continents: the European colonizers, represented mainly by the Portuguese; African slaves; and the autochthonous Amerindians. When the Portuguese arrived, exactly 500 years ago, there were ∼2.5 million indigenous people living in the area of what is now Brazil (Salzano and Freire-Maia 1970; Bethell 1997). The Portuguese-Amerindian admixture started soon after the arrival of the first colonizers. Mating between European men and indigenous women became commonplace and later (after 1755) was even encouraged as a strategy for population growth and colonial occupation of the country (Mörner 1967). The Amerindian tribes underwent a drastic demographic decline due to conflicts with the European colonizers and diseases to which they were not adapted (Salzano and Freire-Maia 1967, 1970; Monteiro 1994; Ribeiro 1995). Today there are ∼326,000 Amerindians in Brazil, living on land set aside for them by the federal government. Africans were introduced beginning in the middle of the 16th century, brought to Brazil as slaves to work on sugarcane farms and, later, in the gold and diamond mines and on coffee plantations. Historical records suggest that between 1551 and 1850 (when the slave trade was abolished), ∼3.5 million Africans arrived in Brazil (Salzano and Freire-Maia 1967; Curtin 1969; Ribeiro 1995). As to the European immigration, it is estimated that ∼500,000 Portuguese arrived in the country between 1500 and 1808 (Salzano and Freire-Maia 1967). From then on, after the Brazilian ports were legally opened to all friendly nations, Brazil received increasing numbers of immigrants from several parts of the world. Portugal remained by far the most important source of migrants, followed by Italy, Spain, and Germany. In the 20th century, Asian immigration took place, mainly from Japan, as well as from Lebanon and Syria. According to Callegari-Jacques and Salzano (1999), 58% of the immigrants who arrived in Brazil between 1500 and 1972 were Europeans, 40% were Africans, and 2% were Asians. The question that arises is, How much did these different groups actually contribute to the gene pool of present-day Brazilians?

Several studies were performed during recent decades, in an attempt to characterize the genetic background of the non-Amerindian Brazilian population (for a review, see Salzano 1997; Callegari-Jacques and Salzano 1999; Dornelles et al. 1999; Guerreiro et al. 1999). These studies included mainly samples from the northern and southern regions of the country. On the basis of classical genetic markers, these studies demonstrated that all analyzed groups show some degree of admixture and that the extent of admixture varied, depending on the region analyzed. Recently, some Brazilian population samples have been analyzed for mtDNA (Bortolini and Salzano 1996; Santos et al. 1996b; Ward et al. 1996; Bortolini et al. 1997b; Batista dos Santos et al. 1999) and Y-chromosome polymorphisms (Batista dos Santos et al. 1999). The mtDNA studies have shown that Amerindian and African contributions to northern Brazilians are larger than those previously observed on the basis of classical markers (Batista dos Santos et al. 1999; Santos et al. 1999).

mtDNA analysis has been used extensively during the past 10 years, since the pioneering works of Vigilant (1990), Stoneking et al. (1991), and Vigilant et al. (1991). Phylogeographic analysis of mtDNA lineages from all over the world has led to the identification of mtDNA haplogroups that are specific to either Africans, Europeans, or Asians/Amerindians (Torroni et al. 1993, 1994, 1996, 1998; Chen et al. 1995; Richards et al. 1996; Watson et al. 1997; Kivisild et al. 1999a, 1999b; Macaulay et al. 1999; Metspalu et al. 1999). Haplogroup allocation of a given mtDNA lineage allows the assessment of its (sub)continental origin, so that the matrilineal ancestry of admixed populations can be evaluated well (Torroni et al. 1995; Bravi et al. 1997; Green et al. 2000; Rando et al. 1999).

In the present article, we follow this approach by sequencing part of the control region and by screening specific RFLP sites, to better understand the extent of the matrilineal genetic contribution of Europeans, Africans, Amerindians, and Asians to the gene pool of present-day Brazilians.

Subjects and Methods

Samples

We analyzed 247 unrelated Brazilian individuals (mainly classified as “white” in Brazil and belonging to the middle and upper-middle classes) who came from four of the five major geographic regions of the country (fig. 1). According to the Instituto Brasileiro de Geografia Estatística, responsible for the census in Brazil, 51.6% of Brazilians in 1996 classified themselves as white. In detail, there were 99 individuals from the southeastern (mostly from the state of Minas Gerais), 50 from the southern (states of Rio Grande do Sul, Santa Catarina, and Paraná), 48 from the northern (states of Amazonas, Pará, Rondônia, and Acre), and 50 from the northeastern (state of Pernambuco) regions. Thirty-seven individuals were students or staff in our laboratory, whereas 210 were randomly chosen unrelated participants in paternity-testing studies. Written consent was obtained from all participants, and all analyses were performed anonymously.

Figure 1 .

Figure  1

Five major geographic regions of Brazil: N = northern, NE = northeastern, SE = southeastern, S = southern, and CW = central west. Brazilian states from which the mtDNA lineages of the present study have mainly been sampled are indicated by name.

mtDNA Control-Region Amplification and Sequencing

The nucleotide sequence of mtDNA hypervariable segment I (HVS-I), between nucleotide positions (np) 16060 and 16362, was determined for all the individuals in the study (see GenBank accession numbers in the Electronic-Database Information section). PCR amplification of the mtDNA control region was performed in a 45-μl volume. Each tube contained 0.8 μM of primers L15926 5′-TCAAAGCTTACACCAGTCTTGTAAAACC-3′ and H16498 5′-CCTGAAGTAGGAACCAGATG-3′, 200 μM dNTP, and 0.5 U of Taq DNA polymerase (Promega). Thirty cycles of denaturation at 94°C for 1 min, annealing at 55°C for 30 s, and an extension at 72°C for 1 min were done. Negative controls were run simultaneously, to detect reagent contamination. PCR products were visualized in 1% agarose-gel electrophoresis with ethidium bromide. Amplified segments were purified using Magic PCR Preps (Promega), and dideoxy sequencing was done with the Thermo Sequenase Sequencing Kit (Amersham Life Science) and a fluorescent-labeled primer L15996 5′-CTCCACCATTAGCACCCAAAGC-3′ or H16401 5′-TGATTTCACGGAGGATGGTG-3′. For the samples from the southeastern region, the HVS-II sequence between np 72 and 337 was also determined. Primers L29 5′-GGTCTATCACCCTATTAACCAC-3′ and H580 5′-TTGAGGAGGTAAGCTACATA-3′ were used in PCR reactions, in the same conditions described above, and a fluorescent-labeled primer L48 5′-CTCACGGGAGCTCTCCATGC-3′ or H408′ 5′-CTGTTAAAAGTGCATACCGCCA-3′, was used in sequencing reactions.

Partial Restriction-Site Analysis

Several amplified segments, mainly in the mtDNA coding regions, were analyzed by RFLP tests, according to the method described by Chen et al. (1995) and Torroni et al. (1996), to screen haplogroup-specific sites (table 1). PCR amplifications were performed using the primers and conditions described by Torroni et al. (1992, 1993, 1996). Digestions were carried out according to the conditions specified by the manufacturer (Gibco BRL). The resulting fragments were resolved by electrophoresis in 1% agarose gels and were visualized by UV-induced fluorescence after ethidium bromide staining. Depending on the number and length of resulting fragments, they were visualized in 8% acrylamide gels after silver staining. The 12308 HinfI polymorphic site was analyzed using the mismatched primer described by Torroni et al. (1996).

Table 1.

RFLP Polymorphisms Used to Identify mtDNA Haplogroups and Geographic Origin

Statusa
Haplogroup Characteristic Restriction Site(s) Sub-SaharanAfrican NativeAmerican European
L1a +3592 HpaI, +11641 HaeIII +
L1b +3592 HpaI, −7055 AluI, +2349 MboI +
L1c +3592 HpaI, +9070 TaqI, +12810 RsaI +
L2 +3592 HpaI, +16389 HinfI +
L3b +10084 TaqI +
L3d −3592 HpaI, −8616 MboI +
L3e −3592 HpaI, +2349 MboI +
A +663 HaeIII +
B 9-bp deletion +
C −13259 HincII +
D −5176 AluI +
H −7025 AluI +
V −4577 NlaIII +
HV −14766 MseI +
U +12308 HinfI +
K −9052 HaeII +
J −13704 BstNI +
T +13366 BamHI, +15606 AluI +
I −4529 HaeII, +8249 AvaII, +16389 BamHI, +10032 AluI +
W +8249 AvaII, −8994 HaeIII +
X −1715 DdeI + +

a

A plus sign (+) denotes that the haplogroup is indigenous; a minus sign (−) denotes that it is not.

Phylogeographic Analysis

We build on the phylogenetic analyses of European (Richards et al. 1998; Macaulay et al. 1999) and African (Rando et al. 1998) mtDNA, which combine HVS-I and RFLP information. According to the nomenclature of those analyses, human mtDNAs are divided into three supergroups—L1 (+3592 HpaI, −10806 HinfI), L2 (+3592 HpaI, −16390 HinfI), and L3 (−3592 HpaI). L1 and L3 are further subdivided into haplogroups, which can be recognized by specific restriction sites (table 1). L1 and L2 are African specific, whereas L3 is ubiquitous but encompasses several haplogroups that are (nearly) continent specific. From HVS-I sequences alone, the fine-grained haplogroup status can be read off only to some extent, and, therefore, their characteristic restriction site(s) need to be tested for confirmation. In the case of haplogroups that are shared between continents, HVS-I motifs or exclusive matches could further suggest the most plausible geographic origin. Figure 2 displays the hierarchy of haplogroups that is relevant for the present study. Note that haplogroup U includes haplogroup K. In the fine classification of mtDNA lineages, we employ the “asterisk notation” (Richards et al. 1998): an mtDNA lineage belongs to some haplogroup labeled with an asterisk if it is a member of that group but not of any otherwise-highlighted subgroup.

Figure 2 .

Figure  2

Classification tree highlighting selected diagnostic sites and positions for haplogroups present in the Brazilian sample (see tables 1 andtable 6table 6). Each square represents the root node of the respective haplogroup, with the acronym inscribed; two central/eastern-African haplogroups, represented by circles, are only partially characterized (T. Kisivild, personal communication). “CRS” indicates the revised reference sequence (Andrews et al. 1999). Numbers along links refer to RFLP sites (with arrows pointing to presence of sites) or transitions, unless a single-letter suffix indicates a transversion. Note that some diagnostic sites and positions, especially in the control region, have undergone recurrent mutations. The root of the tree, labeled “mtEve,” is inferred by employing the Neanderthal HVS-I and HVS-II sequences (Krings et al. 1997, 1999) and the coding-region sequences of bonobo and common chimpanzee (Horai et al. 1995) as outgroups; this corroborates the rooting of the Vigilant (1990) tree.

Results

mtDNA Composition of the Brazilian Population

The 247 Brazilian mtDNA lineages, yielding 170 different HVS-I haplotypes, can be perfectly allocated to the known haplogroups (tables22 and 3 and fig. 2). Altogether, 82 mtDNA lineages fall into the Native American/Asian haplogroups, A–D (with one A lineage of confirmed western-Asian ancestry), whereas 69 belong to various African haplogroups and 96 belong to European haplogroups. The relative frequencies of these continental fractions of the mtDNA pool, though, vary considerably over the four Brazilian regions analyzed. In the northern region, the majority of the mtDNA lineages are of Native American ancestry, whereas African ancestry is most prominent in the northeastern region, with the southeastern region being intermediate between the two former regions in this regard; finally, the southern region stands out, with a great majority of European mtDNA lineages (table 4).

Table 2.

HVS-I Haplotypes and Their Regional Distribution in Brazil

Regional Distributionb
Nucleotide Positionc
Haplotypea SE S NE N 000000000111111111111111111111111111111111122222222222222222222222222222222222222222222233333333333333333333667788999011222444444555556666777778888889901111122222333444445556666667777788899999999900011111222444555566 791516378414469124578346782368246894567892393478912345049012894690124560124867801234567814912689057248456702 Haplogroupd
CRSe CCCTATTTACCCTTGACTGCCGTGTAAAACTCCTCCCCCCTCCTGCTCACCCTCACCAACCTACCCCCCACCTAGCCCTCCCACCCTTCTATAAAGCTCTCCCCTTCT
Native American/Asian:
 BR1 1 1 1 1 ..........T........................................T...........................T...............A...........C A
 BR2 1 .......CG.T.....T.......................C..........T...........................T...............AT..........C A
 BR3 1 .......CG.T...............................T........T...........................T...............AT..........C A
 BR4 1 1 ..........T..C.....................................T............T..............T...............A...........C A
 BR5 1 ..........T..C.....................................T............T..............T...............A..T........C A
 BR6 1 ..........T...A.........................C..........T...........................T...........C...A...........C A
 BR7 2 1 ..........T.............................C..........T...........................T...............A...........C A
 BR8 1 ..........T..............................T.........T...........................T...............A...........C A
 BR9 1 1 ..........T................................C.......T...........................T...............A...........C A
 BR10 1 1 ..........T....................................T...T....A.............T........T...............A...........C A
 BR11 1 ..........T....................................T...T..................T........T...............A...........C A
 BR12 1 ..........T........................................T..................T........T...............A...........C A
 BR13 1 ...................................................T...........................T...............A...........C A
 BR14 2 .............C.....................................T.......................T...T...............A...........C A
 BR15 1 ........................................C..........T...........................T...............A...........C A
 BR16 1 ...................................................T.......T...................T...............A............ A
 BR17 3 1 1 5 ........................................C.....C............................................................. B
 BR18 1 ...........T............................C.....C............................................................. B
 BR19 1 .............C..........................C.....C............................................................. B
 BR20 1 .............C..........................C.....C......................................................T...... B
 BR21 1 ..............A..................C......C.....C............................................................. B
 BR22 1 .................................C......C.....C............................................................. B
 BR23 1 ..............................C.........C.....C............T................................................ B
 BR24 1 ...............................T........C.....C............................................................. B
 BR25 1 ........................................C.....C........T.................................................... B
 BR26 1 1 ........................................C.....C...........G................................................. B
 BR27 1 ........................................C.....C..............C..............................G.......T....... B
 BR28 1 ........................................C.....C..............C...................T..........G.......T....... B
 BR29 1 ........................................C.....C...........................A................................. B
 BR30 1 .......................................TC.....C............................................................. B
 BR31 2 1 ...................................................T...................................C.........CT......... C
 BR32 1 .T.................................................T...................................C.........CT......... C
 BR33 1 .........A...C.....................................T...................................C.........CT......... C
 BR34 1 .............C.....................................T...................................C.........CT......... C
 BR35 1 ...............G........C..........................T...............................T...C.........CT......... C
 BR36 1 ...................T...............................T...................................C.........CT......... C
 BR37 1 ...................T............T..................T...................................C.........CT......... C
 BR38 1 ................................T..................T...................................C.........CT......... C
 BR39 1 1 ..............................C....................T...................................C.........CT......... C
 BR40 1 ...................................................TC............T.....................C.........CT.....C... C
 BR41 1 ...................................................T.....................G.............C.........CT......... C
 BR42 1 1 ...................................................T........A..........................C.........CT.......T. C
 BR43 1 1 ...................................................T.............................T.....C.........CT........C C
 BR44 2 ...................................................T.............................................CT......... C
 BR45 2 ...................................................T.............................................C.........C D
 BR46 1 ...................................................T............................T...T............C.........C D
 BR47 1 ................T.................T................T................................T............C.........C D
 BR48 1 1 2 ......................................A............T.............................................C.........C D
 BR49 1 ...................................................T.......T...............................C.....C.........C D
 BR50 1 ...........................................C.......T.............................................C.........C D
 BR51 1 ........................................C..........T.............................................C.........C D
 BR52 1 ...................................................T.......................................................C D
 BR53 1 ...........A......................T................T......G...................C.........T..........C.......C D
African:
 BR54 1 ....................T.........C.......TGC..........T..G....................................C....T........... L1a
 BR55 2 ..............A.....T........TC.......TGC..........T..G....................................C....T........... L1a
 BR56 1 ..............A.....T........TC.......TGC..........T..G.........................T..........C....T........C.. L1a
 BR57 1 1 ..............A.....T........TC.......TGC..........T..G....................T......G........C....T........... L1a
 BR58 1 ......C.......A.....T........TC.......TGC..........T..G....................T......G........C....T........... L1a
 BR59 1 .............C........................T.C..........T................T..T...T......G........C................ L1b
 BR60 1 ..........T..C........................T.C..........T....T..............T...T......G........C................ L1b
 BR61 1 .............C........................T.C.T........T................T..T...T...............C................ L1b
 BR62 1 ..............A.......................T.C....T.....T.................C.....TA...T..T.......C..............T. L1c
 BR63 1 ......C.......A.......................T.C..........T.................C.....TG......T.......C..............T. L1c
 BR64 1 ..T...C.......A...A.........G.........T.C...A......T...T.............C.....TG......T.......C..............T. L1c
 BR65 1 ..............A............G..........T.C............................C.....TG......T.......C..............T. L1c
 BR66 2 ..............A............G..........T.C..C.......T.......................T......GT.......C..............T. L1c
 BR67 1 .........T.................G..........T.C..........T.......................T......GT.......C..............T. L1c
 BR68 1 ......................................T.C..........T.......................T......GT.......C..............T. L1c
 BR69 1 ..............A.......................T.C..........T.......................T......GT.......C..............T. L1c
 BR70 1 ..............A.......................T.C..............................T...T......GT.......C..............T. L1c
 BR71 1 .....C........A.......................T.C..........T......G...............AT....T.GT.......C..............T. L1c
 BR72 1 ..............A............G..........T.C..........T.......................T......GT.......C..............T. L1c
 BR73 1 ........................................C..........T.......................T......GT.......C..............T. L1c
 BR74 1 ........................................C..........T.......................T.......T......G................. L2
 BR75 1 ........................................C..........TCT.T...................T.......T......G................. L2
 BR76 1 1 ........................................CT.........T.......................T.......T......G................. L2
 BR77 1 ...................................................T.......................T.......T......G................. L2
 BR78 1 ...................................................T.......................T.......T........................ L2
 BR79 1 ...................................................T..G....................T.......T........................ L2
 BR80 1 ..........A.......A................T...............T....T..................T.....T.........C...........T.... L2
 BR81 2 ...................................................T................T......T...............C................ L2
 BR82 1 ...................................................T................T.T....T................................ L2
 BR83 1 ...........A..A.............................A......T.......................T..........................T..... L2
 BR84 1 ...........A..A.............................A......T.......................T................................ L2
 BR85 1 ...................................................TC......................T........T....................... L2
 BR86 1 ..............A...............C....................T.......................................C................ L3d
 BR87 1 ............C...........................C..........T...T...................T.............C.C................ L3d
 BR88 1 ............C......................................T.......................................C................ L3d
 BR89 1 ......C.....C......................................T........................................................ L3d
 BR90 1 ...................................................T..............................................T......... L3e
 BR91 3 ................................T..................T..............................................T......... L3e
 BR92 1 ..............................C....................T..............................................T......... L3e
 BR93 1 .........T....A.........................C..........T.............T.......................................... L3e
 BR94 1 ....................................T..............T..............................................T......... L3e
 BR95 1 ..................A.................T..............T..............................................T......... L3e
 BR96 1 ....................................T..............T.......................................C................ L3e
 BR97 1 ....................................T......C.......T...........T..................................T......... L3e
 BR98 1 ...................................................T..........G.................................T........... L3e
 BR99 1 ...................................................T...............................T............T........... L3e
 BR100 1 ...................................................T.......................................C....T........... L3e
 BR101 2 1 ..............................C.........C..........T............................................T........... L3e
 BR102 1 ..............................C.........C..........T.......................................C....T........... L3e
 BR103 1 ..............................C.........C..........T..................T.........................T........... L3e
 BR104 1 ......C............................................T.................T.......................G.............. L3e
 BR105 1 ....G..............................................T.................T.......................G.............. L3e
 BR106 1 ......C............................................T.................T...................................... L3e
 BR107 1 ......G..................................T.........T.........................A....T.....T..C...........T...C L3*
 BR108 1 ......G............................................T.........................A....T.....T..C...........T...C L3*
 BR109 1 ..............A............................C.......T............................TT..T......C............... L3*
 BR110 1 .........................G....C.........C.......G..........................T................................ U6
 BR111 1 1 1 ..............................C.........C.......G..........................T......G........................C U6
European:
 BR112 10 7 2 4 ............................................................................................................ H
 BR113 1 ......C..................................................................................................... H
 BR114 1 ............C.........................................................................................T..... H
 BR115 1 ..............A..............................................C.............................................. H
 BR116 1 ...C....................................C...............................................................C... H
 BR117 2 ........................................C...............................................................C... H
 BR118 1 ........................................C................................................................... H
 BR119 1 ..........................G................................................................................. H
 BR120 1 .........................................T................................A................................C H
 BR121 1 ............................................A............................................................... H
 BR122 1 .................................................T.......................................................... H
 BR123 1 .......................................................T...................................C...............C H
 BR124 1 ...................................................................T.......T................................ H
 BR125 1 ...........................................................................T................................ H
 BR126 1 ..................................................................................G.......G................. H
 BR127 1 ..................................................................................G......................... H
 BR128 1 ...........................................................................................................C H
 BR129 1 .........................................................................................C.................. H
 BR130 1 ...........................................................................................C................ H
 BR131 1 1 ......................................T................................................C...C................ pre*V
 BR132 1 ...............................................................T.......................C.................... pre*V
 BR133 1 .......................................................................................C.................... V
 BR134 1 ........................................C..............................................C.................... V
 BR135 1 .....................A.................................................................C.................... V
 BR136 1 .....C.................................................................................C.................... V
 BR137 2 .......................................................................................C...............T.... V
 BR138 1 .........................................A.................................................................. HV*
 BR139 1 1 ..............C.........................C..................................................................C U2
 BR140 1 1 ..................................T.....................................................................C... U4
 BR141 1 ........................................C..............................T..A................C.....C.......... U5b*
 BR142 1 ........................................C..............................T.................................... U5b*
 BR143 1 .................C....................T.C..............................T.................................... U5b1
 BR144 1 ..........................................................................................G...T............. U7
 BR145 1 ...........................................................................................C................ K
 BR146 1 1 ....................................................C......................................C................ K
 BR147 1 ........................................C...........C......................................C................ K
 BR148 1 .......................A............................C....C.................................C................ K
 BR149 1 ......C.............................................C......................................C...A............ K
 BR150 1 ....................................................C......................................C...A............ K
 BR151 1 .............C........C....................................................................................C pre*HV
 BR152 1 2 1 2 .T...........C.............................................................................................. J*
 BR153 1 .T...........C....................................T......................................................... J*
 BR154 1 .T....C......C.............................................................T................................ J*
 BR155 1 .T...........C....A...............................................T.................................T....... J1*
 BR156 2 .T...........C....A...........C...................T...............T......................................... J1b1
 BR157 1 ......C......C..........................................................C..........T.T...C.................. T*
 BR158 1 1 1 .............C.....................................................................T.T...C.................. T*
 BR159 1 .............C.....T................................C..............................T.TC..C.................C T*
 BR160 1 .............C.....................................................................T.T...................... T*
 BR161 1 .............C.....................................................................T.T.....C................ T*
 BR162 1 .............C.......A.............................................................T.T...................... T*
 BR163 1 .............C.......A.............................................................T......................T. T*
 BR164 1 T..........T.C.......A...................T.........................................T........................ T*
 BR165 1 .............C...................................................................T.T........................ T*
 BR166 1 1 .............C.............G.........T..C..........................................T........................ T1
 BR167 1 ..............A....................................T........................................................ I
 BR168 1 ........................................C..........T........T..............T................................ X
 BR169 1 ........................................C..........T.....G...........G.....T................................ X
 BR170  1          ........................................C..........T.......................T................................ X
  Total 99 50 50 48

a

BR13 and BR14 share the loss of 3534 DdeI, whereas controls BR4, BR5, BR15, and BR16 were +3534 DdeI. BR132 has C at np 72, and for BR139 the U2-characteristic transition at np 16051 has been confirmed.

b

SE = southeastern, S = southern, NE = northeastern, N = northern.

c

The prefix “16” has been deleted from all (three-digit) numbers. Length polymorphisms in the C run (np 16184 and 16193) are disregarded.

d

Confirmed by testing required restriction sites, listed in table 1, for each lineage (except for sites +9070 TaqI and +12810 RsaI in BR69 and BR70); more-extensive screening was performed for the lineages of status L3e*, pre*V, and pre*HV (see table 3).

e

Source: Andrews et al. (1999).

Table 2.

HVS-I Haplotypes and Their Regional Distribution in Brazil

Regional Distribution b
Nucleotide Positionc
Haplotypea SE S NE N 000000000111111111111111111111111111111111122222222222222222222222222222222222222222222233333333333333333333667788999011222444444555556666777778888889901111122222333444445556666667777788899999999900011111222444555566 791516378414469124578346782368246894567892393478912345049012894690124560124867801234567814912689057248456702 Haplogroupd
CRSe CCCTATTTACCCTTGACTGCCGTGTAAAACTCCTCCCCCCTCCTGCTCACCCTCACCAACCTACCCCCCACCTAGCCCTCCCACCCTTCTATAAAGCTCTCCCCTTCT
Native American/Asian:
 BR1 1 1 1 1 ..........T........................................T...........................T...............A...........C A
 BR2 1 .......CG.T.....T.......................C..........T...........................T...............AT..........C A
 BR3 1 .......CG.T...............................T........T...........................T...............AT..........C A
 BR4 1 1 ..........T..C.....................................T............T..............T...............A...........C A
 BR5 1 ..........T..C.....................................T............T..............T...............A..T........C A
 BR6 1 ..........T...A.........................C..........T...........................T...........C...A...........C A
 BR7 2 1 ..........T.............................C..........T...........................T...............A...........C A
 BR8 1 ..........T..............................T.........T...........................T...............A...........C A
 BR9 1 1 ..........T................................C.......T...........................T...............A...........C A
 BR10 1 1 ..........T....................................T...T....A.............T........T...............A...........C A
 BR11 1 ..........T....................................T...T..................T........T...............A...........C A
 BR12 1 ..........T........................................T..................T........T...............A...........C A
 BR13 1 ...................................................T...........................T...............A...........C A
 BR14 2 .............C.....................................T.......................T...T...............A...........C A
 BR15 1 ........................................C..........T...........................T...............A...........C A
 BR16 1 ...................................................T.......T...................T...............A............ A
 BR17 3 1 1 5 ........................................C.....C............................................................. B
 BR18 1 ...........T............................C.....C............................................................. B
 BR19 1 .............C..........................C.....C............................................................. B
 BR20 1 .............C..........................C.....C......................................................T...... B
 BR21 1 ..............A..................C......C.....C............................................................. B
 BR22 1 .................................C......C.....C............................................................. B
 BR23 1 ..............................C.........C.....C............T................................................ B
 BR24 1 ...............................T........C.....C............................................................. B
 BR25 1 ........................................C.....C........T.................................................... B
 BR26 1 1 ........................................C.....C...........G................................................. B
 BR27 1 ........................................C.....C..............C..............................G.......T....... B
 BR28 1 ........................................C.....C..............C...................T..........G.......T....... B
 BR29 1 ........................................C.....C...........................A................................. B
 BR30 1 .......................................TC.....C............................................................. B
 BR31 2 1 ...................................................T...................................C.........CT......... C
 BR32 1 .T.................................................T...................................C.........CT......... C
 BR33 1 .........A...C.....................................T...................................C.........CT......... C
 BR34 1 .............C.....................................T...................................C.........CT......... C
 BR35 1 ...............G........C..........................T...............................T...C.........CT......... C
 BR36 1 ...................T...............................T...................................C.........CT......... C
 BR37 1 ...................T............T..................T...................................C.........CT......... C
 BR38 1 ................................T..................T...................................C.........CT......... C
 BR39 1 1 ..............................C....................T...................................C.........CT......... C
 BR40 1 ...................................................TC............T.....................C.........CT.....C... C
Native American/ Haplogroupd
 BR41 1 ...................................................T.....................G.............C.........CT......... C
 BR42 1 1 ...................................................T........A..........................C.........CT.......T. C
 BR43 1 1 ...................................................T.............................T.....C.........CT........C C
 BR44 2 ...................................................T.............................................CT......... C
 BR45 2 ...................................................T.............................................C.........C D
 BR46 1 ...................................................T............................T...T............C.........C D
 BR47 1 ................T.................T................T................................T............C.........C D
 BR48 1 1 2 ......................................A............T.............................................C.........C D
 BR49 1 ...................................................T.......T...............................C.....C.........C D
 BR50 1 ...........................................C.......T.............................................C.........C D
 BR51 1 ........................................C..........T.............................................C.........C D
 BR52 1 ...................................................T.......................................................C D
 BR53 1 ...........A......................T................T......G...................C.........T..........C.......C D
African:
 BR54 1 ....................T.........C.......TGC..........T..G....................................C....T........... L1a
 BR55 2 ..............A.....T........TC.......TGC..........T..G....................................C....T........... L1a
 BR56 1 ..............A.....T........TC.......TGC..........T..G.........................T..........C....T........C.. L1a
 BR57 1 1 ..............A.....T........TC.......TGC..........T..G....................T......G........C....T........... L1a
 BR58 1 ......C.......A.....T........TC.......TGC..........T..G....................T......G........C....T........... L1a
 BR59 1 .............C........................T.C..........T................T..T...T......G........C................ L1b
 BR60 1 ..........T..C........................T.C..........T....T..............T...T......G........C................ L1b
 BR61 1 .............C........................T.C.T........T................T..T...T...............C................ L1b
 BR62 1 ..............A.......................T.C....T.....T.................C.....TA...T..T.......C..............T. L1c
 BR63 1 ......C.......A.......................T.C..........T.................C.....TG......T.......C..............T. L1c
 BR64 1 ..T...C.......A...A.........G.........T.C...A......T...T.............C.....TG......T.......C..............T. L1c
 BR65 1 ..............A............G..........T.C............................C.....TG......T.......C..............T. L1c
 BR66 2 ..............A............G..........T.C..C.......T.......................T......GT.......C..............T. L1c
 BR67 1 .........T.................G..........T.C..........T.......................T......GT.......C..............T. L1c
 BR68 1 ......................................T.C..........T.......................T......GT.......C..............T. L1c
 BR69 1 ..............A.......................T.C..........T.......................T......GT.......C..............T. L1c
 BR70 1 ..............A.......................T.C..............................T...T......GT.......C..............T. L1c
 BR71 1 .....C........A.......................T.C..........T......G...............AT....T.GT.......C..............T. L1c
 BR72 1 ..............A............G..........T.C..........T.......................T......GT.......C..............T. L1c
 BR73 1 ........................................C..........T.......................T......GT.......C..............T. L1c
 BR74 1 ........................................C..........T.......................T.......T......G................. L2
 BR75 1 ........................................C..........TCT.T...................T.......T......G................. L2
 BR76 1 1 ........................................CT.........T.......................T.......T......G................. L2
 BR77 1 ...................................................T.......................T.......T......G................. L2
 BR78 1 ...................................................T.......................T.......T........................ L2
 BR79 1 ...................................................T..G....................T.......T........................ L2
 BR80 1 ..........A.......A................T...............T....T..................T.....T.........C...........T.... L2
 BR81 2 ...................................................T................T......T...............C................ L2
 BR82 1 ...................................................T................T.T....T................................ L2
 BR83 1 ...........A..A.............................A......T.......................T..........................T..... L2
 BR84 1 ...........A..A.............................A......T.......................T................................ L2
 BR85 1 ...................................................TC......................T........T....................... L2
 BR86 1 ..............A...............C....................T.......................................C................ L3d
 BR87 1 ............C...........................C..........T...T...................T.............C.C................ L3d
 BR88 1 ............C......................................T.......................................C................ L3d
 BR89 1 ......C.....C......................................T........................................................ L3d
 BR90 1 ...................................................T..............................................T......... L3e

Table 2 (Continued).

HVS-I Haplotypes and Their Regional Distribution in Brazil

Regional Distribution b
Nucleotide Positionc
Haplotypea SE S NE N 000000000111111111111111111111111111111111122222222222222222222222222222222222222222222233333333333333333333667788999011222444444555556666777778888889901111122222333444445556666667777788899999999900011111222444555566 791516378414469124578346782368246894567892393478912345049012894690124560124867801234567814912689057248456702 Haplogroupd
Native American/ Haplogroupd
 BR91 3 ................................T..................T..............................................T......... L3e
 BR92 1 ..............................C....................T..............................................T......... L3e
 BR93 1 .........T....A.........................C..........T.............T.......................................... L3e
 BR94 1 ....................................T..............T..............................................T......... L3e
 BR95 1 ..................A.................T..............T..............................................T......... L3e
 BR96 1 ....................................T..............T.......................................C................ L3e
 BR97 1 ....................................T......C.......T...........T..................................T......... L3e
 BR98 1 ...................................................T..........G.................................T........... L3e
 BR99 1 ...................................................T...............................T............T........... L3e
 BR100 1 ...................................................T.......................................C....T........... L3e
 BR101 2 1 ..............................C.........C..........T............................................T........... L3e
 BR102 1 ..............................C.........C..........T.......................................C....T........... L3e
 BR103 1 ..............................C.........C..........T..................T.........................T........... L3e
 BR104 1 ......C............................................T.................T.......................G.............. L3e
 BR105 1 ....G..............................................T.................T.......................G.............. L3e
 BR106 1 ......C............................................T.................T...................................... L3e
 BR107 1 ......G..................................T.........T.........................A....T.....T..C...........T...C L3*
 BR108 1 ......G............................................T.........................A....T.....T..C...........T...C L3*
 BR109 1 ..............A............................C.......T............................TT..T......C............... L3*
 BR110 1 .........................G....C.........C.......G..........................T................................ U6
 BR111 1 1 1 ..............................C.........C.......G..........................T......G........................C U6
European:
 BR112 10 7 2 4 ............................................................................................................ H
 BR113 1 ......C..................................................................................................... H
 BR114 1 ............C.........................................................................................T..... H
 BR115 1 ..............A..............................................C.............................................. H
 BR116 1 ...C....................................C...............................................................C... H
 BR117 2 ........................................C...............................................................C... H
 BR118 1 ........................................C................................................................... H
 BR119 1 ..........................G................................................................................. H
 BR120 1 .........................................T................................A................................C H
 BR121 1 ............................................A............................................................... H
 BR122 1 .................................................T.......................................................... H
 BR123 1 .......................................................T...................................C...............C H
 BR124 1 ...................................................................T.......T................................ H
 BR125 1 ...........................................................................T................................ H
 BR126 1 ..................................................................................G.......G................. H
 BR127 1 ..................................................................................G......................... H
 BR128 1 ...........................................................................................................C H
 BR129 1 .........................................................................................C.................. H
 BR130 1 ...........................................................................................C................ H
Native American/ Haplogroupd
 BR131 1 1 ......................................T................................................C...C................ pre*V
 BR132 1 ...............................................................T.......................C.................... pre*V
 BR133 1 .......................................................................................C.................... V
 BR134 1 ........................................C..............................................C.................... V
 BR135 1 .....................A.................................................................C.................... V
 BR136 1 .....C.................................................................................C.................... V
 BR137 2 .......................................................................................C...............T.... V
 BR138 1 .........................................A.................................................................. HV*
 BR139 1 1 ..............C.........................C..................................................................C U2
 BR140 1 1 ..................................T.....................................................................C... U4
 BR141 1 ........................................C..............................T..A................C.....C.......... U5b*
 BR142 1 ........................................C..............................T.................................... U5b*
 BR143 1 .................C....................T.C..............................T.................................... U5b1
 BR144 1 ..........................................................................................G...T............. U7
 BR145 1 ...........................................................................................C................ K
 BR146 1 1 ....................................................C......................................C................ K
 BR147 1 ........................................C...........C......................................C................ K
 BR148 1 .......................A............................C....C.................................C................ K
 BR149 1 ......C.............................................C......................................C...A............ K
 BR150 1 ....................................................C......................................C...A............ K
 BR151 1 .............C........C....................................................................................C pre*HV
 BR152 1 2 1 2 .T...........C.............................................................................................. J*
 BR153 1 .T...........C....................................T......................................................... J*
 BR154 1 .T....C......C.............................................................T................................ J*
 BR155 1 .T...........C....A...............................................T.................................T....... J1*
 BR156 2 .T...........C....A...........C...................T...............T......................................... J1b1
 BR157 1 ......C......C..........................................................C..........T.T...C.................. T*
 BR158 1 1 1 .............C.....................................................................T.T...C.................. T*
 BR159 1 .............C.....T................................C..............................T.TC..C.................C T*
 BR160 1 .............C.....................................................................T.T...................... T*
 BR161 1 .............C.....................................................................T.T.....C................ T*
 BR162 1 .............C.......A.............................................................T.T...................... T*
 BR163 1 .............C.......A.............................................................T......................T. T*
 BR164 1 T..........T.C.......A...................T.........................................T........................ T*
 BR165 1 .............C...................................................................T.T........................ T*
 BR166 1 1 .............C.............G.........T..C..........................................T........................ T1
 BR167 1 ..............A....................................T........................................................ I
 BR168 1 ........................................C..........T........T..............T................................ X
 BR169 1 ........................................C..........T.....G...........G.....T................................ X
 BR170  1          ........................................C..........T.......................T................................ X
  Total 99 50 50 48

a

BR13 and BR14 share the loss of 3534 DdeI, whereas controls BR4, BR5, BR15, and BR16 were +3534 DdeI. BR132 has C at np 72, and for BR139 the U2-characteristic transition at np 16051 has been confirmed.

b

SE = southeastern, S = southern, NE = northeastern, N = northern.

c

The prefix “16” has been deleted from all (three-digit) numbers. Length polymorphisms in the C run (np 16184 and 16193) are disregarded.

d

Confirmed by testing required restriction sites, listed in table 1, for each lineage (except for sites +9070 TaqI and +12810 RsaI in BR69 and BR70); more-extensive screening was performed for the lineages of status L3e*, pre*V, and pre*HV (see table 3).

e

Source: Andrews et al. (1999).

Table 3.

RFLP Sites Screened in Some mtDNAs

Status of Samplea
BR131
Polymorphism BR107 BR108 BR109 Southeastern Northern BR132 BR151
9-bp deletion
663 HaeIII
1715 DdeI + + + + + + +
2349 MboI
3592 HpaI
4216 NlaIII ND ND
4529 HaeII + + + + + + +
4577 NlaIII ND ND + + + + +
5176 AluI + + + + + + +
7025 AluI + + + + + + +
8249 AvaII
8616 MboI + + + + + + +
8994 HaeIII ND + + + + + +
9052 HaeII + + + + + + +
10032 AluI
10084 TaqI
10394 DdeI + + +
10397 AluI ND
12308 HinfI
12406 HpaI + + + +
13259 HincII + + + + + + +
13366 BamHI
13704 BstNI + + + + + + +
14766 MseI ND + ND +
15606 AluI
16389 BamHI
Haplogroup L3* L3* L3* pre*V pre*V pre*V pre*HV

a

A plus sign (+) denotes presence; a minus sign (−) denotes absence; and ND = not done.

Table 4.

Frequency of Continent-Specific mtDNA Haplotypes in the Brazilian mtDNA Pool

Frequency
Continental Fraction Brazil Northern Northeastern Southeastern Southern
Native American .33 .54 .22 .33a .22
African .28 .15 .44 .34 .12
European .39 .31 .34 .31 .66

a

Excludes the single lineage of confirmed Asian ancestry.

Native American Fraction of the Brazilian mtDNA Pool

Haplogroup A is the most frequent haplogroup within the Native American fraction, closely followed by haplogroup B, with C coming next and D last (table 5). As to the regional distribution, the same order of frequencies is observed in the southern and southeastern regions, but C is the leading haplogroup in the northern region, whereas it is the least frequent in the northeastern region.

Table 5.

Haplogroup Frequencies within the Three Continental Fractions of Brazilian mtDNA Pool

Frequency in Brazil
Haplogroup Overall Northern Northeastern Southeastern Southern
NativeAmerican:a
 A .30 .15 .37 .39 .27
 B .29 .31 .27 .30 .27
 C .24 .38 .09 .18 .27
 D  .16  .15  .27  .12  .18
  Total 1.00 1.00 1.00 1.00 1.00
African:
 L1a .10 .18 .06 .17
 L1b .04 .05 .03 .17
 L1c .19 .29 .09 .23 .17
 L2 .20 .14 .23 .23
 L3d .06 .09 .33
 L3e .30 .43 .32 .32
 L3* .04 .05 .06
 U6  .06  .14  …  .06  .17
  Total 1.00 1.00 1.00 1.00 1.00
European:
 H .44 .27 .65 .45 .39
 pre*V .03 .07 .03 .03
 V .06 .06 .13 .03
 HV* .01 .03
 U .16 .13 .18 .16 .15
 pre*HV .01 .03
 J .11 .20 .06 .03 .18
 T .14 .27 .06 .13 .12
 I .01 .07
 X  .03  …  …  .06  .03
  Total 1.00 1.00 1.00 1.00 1.00

a

Excludes the single A lineage (from the southeastern region) of confirmed Asian ancestry.

The major founder haplotypes of the Native American haplogroups A–D (Forster et al. 1996; Smith et al. 1999) are all present in Brazil and are shared with many Native American populations. Interestingly, there are several matches with derived haplotypes in other South American populations: haplotypes BR26, BR27, BR43, and BR47 have been observed elsewhere, in the Amazonian sample of Santos et al. (1996b); haplotype BR14 has also been identified, with the absence of the site 3534 DdeI (table 2table 2, footnote a), in the Krahó from Goiás, Brazil (Torroni et al. 1993); BR51 occurs in the Zoró from Mato Grosso, Brazil, and in the Gavião from Rondônia, Brazil (Ward et al. 1996); haplotype BR39 is found in Colombia (Horai et al. 1993); and BR49 is found in the Mapuche from Argentina (Ginther et al. 1993). Remarkably, one D lineage (BR53) constitutes a true outlier in our sample, since it differs by as many as seven transitions from the D founder haplotype, four of which are shared with a haplotype found in the Cayapa from Ecuador (Rickards et al. 1999).

African Fraction of the Brazilian mtDNA Pool

Haplogroups L3e and L1c together constitute approximately one-half (49%) of the African fraction (table 5). Nowhere in western Africa has such a high percentage been observed so far for this haplogroup pair: 7% is seen in the mtDNA pool of several Senegalese populations (Graven et al. 1995; Rando et al. 1998), and 17% has been seen in the joint mtDNA pool of the Songhai, Yoruba, Hausa, and Kanuri (Watson et al. 1997, table A1). The Bubi, from the island of Bioko in the Gulf of Guinea (central Africa), however, have an mtDNA contribution of 33% L3e and 22% L1c, yielding a joint percentage of 56% (as inferred from table 2table 2 of Mateu et al. 1997). This exceeds even the corresponding relative frequency in our Brazilian sample. On the other hand, haplogroups L3d and L1b, which are quite specific to western Africa, are absent in the Bubi but together occur at a frequency of 10% in the African fraction of the Brazilian mtDNA pool. For this haplogroup pair, much higher frequencies are found in western Africa: 25% in Senegal and 17% among the Songhai, Yoruba, Hausa, and Kanuri. This suggests that the majority of the mtDNA lineages of African ancestry in the Brazilian sample had their origin in central Africa (which would include Cameroon, as well as Angola), although a substantial number must have come from western Africa. Only few mtDNA haplotypes in the Brazilian sample could potentially testify to southeastern-African origin. BR55 would be a good candidate since it perfectly matches the most frequent 9-bp-deletion L1a haplotype, found in Malawi and in southeastern Bantu speakers (Soodyall et al. 1996): the matching involves the 9-bp deletion, HVS-I (table 2table 2), and HVS-II (table 6table 6), even extending to position 64 (which, in this case, could be read with only one primer). The same HVS-I type (with the 9-bp deletion) has been found in São Tomé (Mateu et al. 1997), which served as an entrepôt for the Atlantic slave trade (Curtin 1969).

Table 6.

HVS-II Haplotypes in Southeastern Brazil

Nucleotide Positionb
Haplotypea     11111111111111112222222222222222222222223333333 779904555588888899990000122223334445666788990011122 233536012323568945890347756785694782035967579955657 Haplogroup
CRS TAAAGTCCTACAGCAACTCTAGTGTGTAGATTAGATGATTAACA––––GCC
Native American/Asian:
 BR1 .G...C...G...................G.......G......–––C... A
 BR2 .G...C...G...................G.......G......C––C... A
 BR3 .G...C...G...................G.......G......C––C... A
 BR7(2) .G...C...G..A................G.......G......CC–C... A
 BR8 .G...C...G................C..G.......G......–––C... A
 BR9 .G...C................C......G.......G......C––C... A
 BR10 .G...C...G...................G.......G......C––C... A
 BR11 .G...C...G...................G.......G......C––C... A
 BR12 .G...C...G...................G.......G......CC–C... A
 BR14 .G...C..CG...................G.......G.....GC––C... A
 BR16 .G...C..C..........C.........G.......G......–––C... A
 BR17a .G......C............................G......C––C... B
 BR17b .G...................................G......––––... B
 BR17c .G...................................G......–––C... B
 BR19 .G...................................G......––CC... B
 BR20 .G...................................G......–––C... B
 BR21 .G...................................G......C––C... B
 BR23 .G......C............................G......C––C... B
 BR25 .G.....T............................AG......CC––... B
 BR26 .G..A...C............................G......–––C... B
 BR29 .G......C............................G......C–CC... B
 BR32 .G..................................G..––..C––C... C
 BR39 .G..............T...................G..––..C––C... C
 BR41 .G..................................G..––..C––C... C
 BR42 .G......C...........................G..––..C––C... C
 BR44(2) .G..................................G..––..C––C... C
 BR48 .G...................................G......–––C... D
 BR50 .G.........................G.........G......–––C... D
 BR51 .G...C................CA.............G......–––C... D
 BR53 .G......C............................G......CC–C... D
African:
 BR54 ..G.....C......G......CA......C..A...G......C––C... L1a
 BR58 ..GC........A..G..............C..A...G......–––C... L1a
 BR61 .G......C.T.T....C...A...........A...G......–––C... L1b
 BR64 .G.....TC.T..A.C.CT..............A...G.....GC––CA.. L1c
 BR66(2) .G.....TC.T..A.C.................A...G......–––CA.. L1c
 BR67 .G.....TC.T..A.C.................A...G......–––CA.. L1c
 BR69 .G.....TC.T..A.C.................A...GC.....–––CA.. L1c
 BR70 .G.....TC.T..A.C.C...............A...G.....GC––CA.. L1c
 BR71 .G.....TC.T..A.C.CT..............A...G.....G–––CA.. L1c
 BR73 .G.....TC.T..A.C.CT..............A...G.....G–––CA.. L1c
 BR76 .G...C..C........C...................G......C–––... L2
 BR78 .G...C..C........C...................G......C––C... L2
 BR79 .G...C..C........C.............C.....G......–––C... L2
 BR80 .G...CT.C.T.....T....................G......–––C... L2
 BR81a .GG..CT.C.TG.....CT..................G......–––C.T. L2
 BR81b .GGC.CT.C.TG.....CT..................G......–––C.T. L2
 BR84 .G...CT.C.T......CT...CA.............G......–––C... L2
 BR85 .G.....TC.T......C...................G......C––C... L2
 BR93 .G....T.............G................G......C––C... L3e
 BR95 .G....T.C......G.C..G..A.............G......C––C... L3e
 BR96 .G....T.....A..G.....................G......–––C... L3e
 BR97 .G....T.C......G.C..G..A.............G......––––... L3e
 BR98 .G....T..........CT..................G......–––C... L3e
 BR101(2) .G....T.C............................G......–––C... L3e
 BR102 .G....T..........C...................G......C––C... L3e
 BR103 .G....T..........C...................G......C–––... L3e
 BR105 .G....T..........C...................G......–––C... L3e
 BR106 .G....T........G.C...................G......–––C... L3e
 BR107 .G...CT.C........C..G...........G....G......C––C... L3*
 BR108 .G...CT.C........C..G...........G....G......–––C... L3*
 BR110 .G...C......A....................T...G......–––C... U6
 BR111 .G...........T.......................G......C––C... U6
European:
 BR112a .....................................G......C–––... H
 BR112b(3) .....................................G......C––C... H
 BR112c .....................................G......––––... H
 BR112d(2) .....................................G......–––C... H
 BR112e ......T..............................G......C––C... H
 BR112f ........C............................G......–––C... H
 BR112g .....................................G......CC–C... H
 BR115 .....................................G......C–––... H
 BR120 ...............................C.....G......C––C... H
 BR124 ..G..C......................................–––C... H
 BR130 .....................................G......C––C... H
 BR131 C.....T......T.......................G......C––C... pre*V
 BR133 C.G..............C...................G......C––C... V
 BR134 C....................................G......–––C... V
 BR137(2) C................C...................G......CC––... V
 BR139 .G......C...............C............G......––––... U*
 BR141 .G....T..........C...................G......–––C... U4
 BR142 .G....T.C........C...................G......CC–C... U5b*
 BR146 .G...C..C............................G......–––C... K
 BR149 .G...............C...................G......---C... K
 BR153 .G..........A.G.............A........G....T.C––C... J*
 BR159 .G....T..............................G......–––C... T*
 BR161 .G...................................G......C––C... T*
 BR162 .G.....T.............................G......C––C... T*
 BR166 .G...C..C..........................C.G.C....–––C... T*
 BR170 .G.......G.......C...................G......C––C... X
 BR171 .G.......G.......C.......A.G.........G......–––C... X

a

Position 64 (which could be read for some sequences but only with one primer) is polymorphic in haplogroups L1a and A: BR3, BR8, and BR58 have 64C (like CRS), whereas BR1, BR7, BR9, BR10, BR11, BR12, BR14, BR16, and BR54 have 64T. BR15 could not be analyzed for HVS-II.

b

Haplogroup-diagnostic nucleotide positions are underlined.

Table 6.

HVS-II Haplotypes in Southeastern Brazil

Nucleotide Positionb
Haplotypea     11111111111111112222222222222222222222223333333 779904555588888899990000122223334445666788990011122 233536012323568945890347756785694782035967579955657 Haplogroup
CRS TAAAGTCCTACAGCAACTCTAGTGTGTAGATTAGATGATTAACA––––GCC
Native American/Asian:
 BR1 .G...C...G...................G.......G......–––C... A
 BR2 .G...C...G...................G.......G......C––C... A
 BR3 .G...C...G...................G.......G......C––C... A
 BR7(2) .G...C...G..A................G.......G......CC–C... A
 BR8 .G...C...G................C..G.......G......–––C... A
 BR9 .G...C................C......G.......G......C––C... A
 BR10 .G...C...G...................G.......G......C––C... A
 BR11 .G...C...G...................G.......G......C––C... A
 BR12 .G...C...G...................G.......G......CC–C... A
 BR14 .G...C..CG...................G.......G.....GC––C... A
 BR16 .G...C..C..........C.........G.......G......–––C... A
 BR17a .G......C............................G......C––C... B
 BR17b .G...................................G......––––... B
 BR17c .G...................................G......–––C... B
 BR19 .G...................................G......––CC... B
 BR20 .G...................................G......–––C... B
 BR21 .G...................................G......C––C... B
 BR23 .G......C............................G......C––C... B
 BR25 .G.....T............................AG......CC––... B
 BR26 .G..A...C............................G......–––C... B
 BR29 .G......C............................G......C–CC... B
 BR32 .G..................................G..––..C––C... C
 BR39 .G..............T...................G..––..C––C... C
 BR41 .G..................................G..––..C––C... C
 BR42 .G......C...........................G..––..C––C... C
 BR44(2) .G..................................G..––..C––C... C
 BR48 .G...................................G......–––C... D
 BR50 .G.........................G.........G......–––C... D
 BR51 .G...C................CA.............G......–––C... D
 BR53 .G......C............................G......CC–C... D
African:
 BR54 ..G.....C......G......CA......C..A...G......C––C... L1a
 BR58 ..GC........A..G..............C..A...G......–––C... L1a
 BR61 .G......C.T.T....C...A...........A...G......–––C... L1b
 BR64 .G.....TC.T..A.C.CT..............A...G.....GC––CA.. L1c
 BR66(2) .G.....TC.T..A.C.................A...G......–––CA.. L1c
 BR67 .G.....TC.T..A.C.................A...G......–––CA.. L1c
 BR69 .G.....TC.T..A.C.................A...GC.....–––CA.. L1c
 BR70 .G.....TC.T..A.C.C...............A...G.....GC––CA.. L1c
 BR71 .G.....TC.T..A.C.CT..............A...G.....G–––CA.. L1c
 BR73 .G.....TC.T..A.C.CT..............A...G.....G–––CA.. L1c
 BR76 .G...C..C........C...................G......C–––... L2
 BR78 .G...C..C........C...................G......C––C... L2
 BR79 .G...C..C........C.............C.....G......–––C... L2
 BR80 .G...CT.C.T.....T....................G......–––C... L2
 BR81a .GG..CT.C.TG.....CT..................G......–––C.T. L2
 BR81b .GGC.CT.C.TG.....CT..................G......–––C.T. L2
 BR84 .G...CT.C.T......CT...CA.............G......–––C... L2
 BR85 .G.....TC.T......C...................G......C––C... L2
 BR93 .G....T.............G................G......C––C... L3e
 BR95 .G....T.C......G.C..G..A.............G......C––C... L3e
 BR96 .G....T.....A..G.....................G......–––C... L3e
 BR97 .G....T.C......G.C..G..A.............G......––––... L3e
 BR98 .G....T..........CT..................G......–––C... L3e
 BR101(2) .G....T.C............................G......–––C... L3e
 BR102 .G....T..........C...................G......C––C... L3e

Table 6 (Continued).

HVS-II Haplotypes in Southeastern Brazil

Nucleotide Positionb
Haplotypea     11111111111111112222222222222222222222223333333 779904555588888899990000122223334445666788990011122 233536012323568945890347756785694782035967579955657 Haplogroup
Native American/Asian:
 BR103 .G....T..........C...................G......C–––... L3e
 BR105 .G....T..........C...................G......–––C... L3e
 BR106 .G....T........G.C...................G......–––C... L3e
 BR107 .G...CT.C........C..G...........G....G......C––C... L3*
 BR108 .G...CT.C........C..G...........G....G......–––C... L3*
 BR110 .G...C......A....................T...G......–––C... U6
 BR111 .G...........T.......................G......C––C... U6
European:
 BR112a .....................................G......C–––... H
 BR112b(3) .....................................G......C––C... H
 BR112c .....................................G......––––... H
 BR112d(2) .....................................G......–––C... H
 BR112e ......T..............................G......C––C... H
 BR112f ........C............................G......–––C... H
 BR112g .....................................G......CC–C... H
 BR115 .....................................G......C–––... H
 BR120 ...............................C.....G......C––C... H
 BR124 ..G..C......................................–––C... H
 BR130 .....................................G......C––C... H
 BR131 C.....T......T.......................G......C––C... pre*V
 BR133 C.G..............C...................G......C––C... V
 BR134 C....................................G......–––C... V
 BR137(2) C................C...................G......CC––... V
 BR139 .G......C...............C............G......––––... U*
 BR141 .G....T..........C...................G......–––C... U4
 BR142 .G....T.C........C...................G......CC–C... U5b*
 BR146 .G...C..C............................G......–––C... K
 BR149 .G...............C...................G......---C... K
 BR153 .G..........A.G.............A........G....T.C––C... J*
 BR159 .G....T..............................G......–––C... T*
 BR161 .G...................................G......C––C... T*
 BR162 .G.....T.............................G......C––C... T*
 BR166 .G...C..C..........................C.G.C....–––C... T*
 BR170 .G.......G.......C...................G......C––C... X
 BR171 .G.......G.......C.......A.G.........G......–––C... X

a

Position 64 (which could be read for some sequences but only with one primer) is polymorphic in haplogroups L1a and A: BR3, BR8, and BR58 have 64C (like CRS), whereas BR1, BR7, BR9, BR10, BR11, BR12, BR14, BR16, and BR54 have 64T. BR15 could not be analyzed for HVS-II.

b

Haplogroup-diagnostic nucleotide positions are underlined.

European Fraction of the Brazilian mtDNA Pool

The Brazilian sample includes mtDNA lineages from almost all the familiar European haplogroups (Torroni et al. 1996; Macaulay et al. 1999), except for some marginal ones, such as W and other quite-rare haplogroups related to haplogroup I (Kivisild et al. 1999b). The frequency of the dominant haplogroup H (44%; table 5) in the European fraction is somewhat higher, on average, than that observed in Europe but is well within the range of western-European H frequencies (Torroni et al. 1998). In particular, the relatively high frequency of the Cambridge reference sequence (CRS [Andrews et al. 1999]) haplotype (24%) and of haplogroup pre-V (9%) suggests predominantly western-European ancestry.

The majority of haplotypes from the European fraction already have been recorded in the European mtDNA pool (Richards et al. 1996, 1998; Helgason et al. 2000) and, in many instances, match mtDNA lineages from the Iberian Peninsula. Nevertheless, there are a few sequences for which one would not predict southwestern-European ancestry; the most striking example is the U5b1 haplotype BR143, which bears the “Saami motif” (Sajantila et al. 1995) and is thus of northern Fennoscandian origin.

HVS-II Motifs for Classification of Brazilian mtDNA Lineages

To see to what extent a first sorting into haplogroups could be based on HVS-II sequences, we have sequenced all but one of the mtDNA lineages of the southeastern-Brazilian sample, for HVS-II (table 6table 6). It turns out, by comparison with the data of Vigilant (1990), that haplogroups L1a, L1b, L1c, and an unnamed haplogroup (within L3*) are readily identified individually by one to three positions. L1 is separated from L2 and L3 by a transition at np 247 (fig. 2), which is also evident from the data of Graven et al. (1995). Curiously, np 247 was sorted into the class of most highly mutable positions in HVS-II, by Meyer et al. (1999), although it is known to be virtually unvaried in European mtDNA (see the data sets of Piercy et al. [1993] and Helgason et al. [2000]). The two major African haplogroups, L2 and L3e, represented in the southeastern-Brazilian data set exhibit only diagnostic positions that seem to be hypervariable (np 146, 150, 152, and 195), although HVS-II certainly offers some information for internal classification of L2. Among the Native American haplogroups, only A and C can be detected using HVS-II alone: A is recognized by a transition at np 235, and C is recognized by two deletions (fig. 2). The major HVS-II polymorphism for European mtDNA is at np 73 (Côrte-Real et al. 1996): 73A characterizes pre-HV. Note that 73A is also characteristic of the African haplogroup L1a, but that, in general, np 73 seems to be fairly stable: no further parallel mutation from G to A has been observed, either in our data or in those of Graven et al. (1995), Brown et al. (1998), Macaulay et al. (1999), and Helgason et al. (2000), a result that is at variance with the findings of Salas et al. (1998), who reported J, K, and T lineages with 73A. The few back mutations from A to G that are observed in haplogroup H (Helgason et al. 2000) and L1a (Soodyall et al. 1996) may testify to a directional bias in substitution rates at np 73. Furthermore, only haplogroups pre-V, J, and X can be recognized by single positions in HVS-II; otherwise, HVS-II is not of much help for allocation to European haplogroups. In summary, even this rough HVS-II classification scheme would permit allocation of the majority of the Brazilian mtDNA lineages to the three continental fractions.

Discussion

We examined individuals from four different regions in Brazil (fig. 1), in an attempt to establish a portrait of the mtDNA variation throughout the country and to determine the relative matrilineal contributions of Europeans, Amerindians/Asians, and Africans to present-day white Brazilians. The total sample revealed as much as 33% Amerindian and 28% African contribution to the total mtDNA pool. In fact, these values are probably minimum percentages, because, since our study group is primarily composed of middle- and upper-middle-class Brazilians, a bias toward a higher contribution of European mtDNA is to be expected.

Most of the studies involving the Brazilian population have been performed on Amerindian tribes, mainly from the Amazonian region (Schurr et al. 1990; Torroni et al. 1993; Bailliet et al. 1994; Bianchi et al. 1995; Bortolini and Salzano 1996; Easton et al. 1996; Santos et al. 1996b; Ward et al. 1996; Bortolini et al. 1998a), and predominantly African-derived groups (Schneider et al. 1987; Bortolini et al. 1992, 1995, 1997a, 1997b, 1998b; Arpini-Sampaio et al. 1999; Guerreiro et al. 1999). A small number of studies performed on white Brazilians (deemed to be mostly of European descent) that used mainly protein genetic systems focused on populations from the southern or northern regions (Franco et al. 1982; Rosa et al. 1984; Moraes et al. 1993; Santos et al. 1996a; Batista dos Santos et al. 1999; Dornelles et al. 1999). These studies showed that the amount of Amerindian ancestry in the white Brazilians varies widely and has distinct patterns in the different regions of the country. The highest Amerindian influence was observed in populations of the Amazonian region, where a study analyzing 11 urban populations by use of nuclear markers observed an average of 41% Amerindian ancestry (Santos and Guerreiro 1995). Recent mtDNA analysis of another population from the northern region showed an even higher Amerindian contribution (59% [Batista dos Santos et al. 1999]). In our sample, we also observed a high Amerindian influence in the northern region (54%), corroborating the mtDNA data obtained by Batista dos Santos et al. (1999). In the other regions of Brazil, the genetic contribution from Amerindians is also markedly higher for mtDNA than for nuclear DNA: 22% (table 4) versus 13% (Krieger et al. 1965; Franco et al. 1982; Conceição et al. 1987) in the northeastern region and 22% (table 4) versus 11% (Dornelles et al. 1999) in the southern region. For the southeastern region, where we have detected 33% frequency of mtDNA lineages of Amerindian ancestry, not a single study with nuclear markers has yet been performed, probably because one did not anticipate measurable Amerindian genetic influence on urban populations (Salzano 1997). As for African admixture in the white Brazilian population, the picture is similar to what we have seen for the Amerindian genetic input: mtDNA analysis (table 4) suggests a higher contribution than that by nuclear markers, for which 12% in the northern region (Santos et al. 1996a), 36% in the northeastern region (Franco et al. 1982; Arpini-Sampaio et al. 1999), and 10% in the southern region (Dornelles et al. 1999) were reported; again, no nuclear data are available for the southeastern region.

The allocation of haplogroups to continents (as indicated in table 1) is, of course, not absolutely clear-cut. For instance, the European haplogroups H and U5 do occur in the sub-Saharan mtDNA pool, albeit in only two founder types (bearing transitions at np 16145 and 16222 for the H type and transitions at np 16189, 16192, 16270, and 16320 for the U5 type), possibly transmitted by Berbers or, even earlier, during the Saharan Neolithic age (Rando et al. 1999). None of these particular mtDNA lineages occur in our Brazilian sample. Similarly, northern-African U6 haplotypes have penetrated the Sahara and are found sporadically from the west (Senegal) to the east (Kenya). We consider it most plausible that the four U6 lineages in our sample have come from western Africa. On the other hand, African haplotypes were also transmitted, in low numbers, to Europe, especially to the Mediterranean area. African mtDNA lineages, then, constitute erratic outliers in the respective mtDNA samples, for instance, such as the L1c lineage in the British data of Piercy et al. (1993).

There is one caveat with regard to the distinction between European mtDNA haplotypes and Native American ones: haplogroup X is shared by western Eurasia and North America (Brown et al. 1998; Smith et al. 1999), although there is as yet no compelling evidence for the occurrence of haplogroup X in Central or South America. The three X haplotypes that we detected in the Brazilian sample are certainly of European ancestry, since BR169 and BR170 do not bear the np-200 transition that is characteristic of (most of) the Native American haplogroup X (Brown et al. 1998), whereas BR168 (for which no HVS-II information is available) bears a transition (namely, at np 16248) already observed in Europe (Richards et al. 1998).

The distinction between Asian and Native American mtDNA haplotypes is more intricate inasmuch as haplogroups A–D are of Asian origin. Fortunately, the Native American A, C, and D founder HVS-I and HVS-II types can be distinguished from Asian haplotypes by mutations that are virtually absent, or at least rare, in Asia. The transition at np 16325 is (almost) diagnostic for Native American C and D haplotypes; the 2-bp deletion in HVS-II seems to be characteristic of Native American C (table 6table 6; also see Ginther et al. 1993; Kolman and Bermingham 1997), since it has not been reported in Asian mtDNAs so far (Lee et al. 1997). The “Beringian” transition at np 16111 is seen in most Native American A lineages but is virtually absent in Asia (Horai and Hayasaka 1990; Horai et al. 1993; Torroni et al. 1993; Kolman et al. 1996; Lee et al. 1997). Thus, only haplotype BR16, which, incidentally, matches an mtDNA lineage from Hokkaido (Horai et al. 1996), would be a clear suspect for potential Asian ancestry. In fact, the lineage BR16 (from a student in our laboratory) turned out to be of Lebanese matrilineal ancestry, but its ultimate ancestry would be central/eastern Asian. Taking into account that the mtDNA haplotypes of seemingly Native American ancestry constitute only a small minority in the Asian mtDNA pool, we would realistically assume that no more than, say, one additional mtDNA lineage in our Brazilian sample was actually of eastern-Asian ancestry. The same could be said for western-Asian ancestry, inasmuch as, in our sample, we did not observe any U1, U3, R*, N*, M*, or non-Amerindian C haplotypes that would occur at considerable frequency in western Asia (Macaulay et al. 1999).

One lineage classified as haplogroup D, BR53, lacks the characteristic transition at np 16325 (very possibly because of back mutation) and is considerably different from most other Native American D lineages (Torroni et al. 1993; Horai et al. 1996; Santos et al. 1996b; Ward et al. 1996; Stone and Stoneking 1998); however, exactly as does the unique D lineage of the Mexican sample (Green et al. 2000), it shares three distinguishing mutations (at np 16241, 16301, and 16342) with a haplotype detected in the Cayapa from Ecuador (Rickards et al. 1999). The Cayapa haplotype also bears the transitions at np 16223 and 16362, which are typical of D haplotypes, but Rickards et al. (1999) claimed (without performing the necessary RFLP tests) that only haplogroups A–C were seen in the Cayapa sample. The related Brazilian haplotype was indeed classified as D, according to −5176 AluI, +10394 DdeI, and +10397 AluI, thus strongly suggesting that the “Cayapa-specific” lineages belong to haplogroup D as well.

In principle, it should be possible to narrow the matrilineal ancestry of Brazilians to a geographic scale narrower than that of the (sub)continents (e.g., see Alves-Silva et al. 1999). This, in general, requires extensive phylogeographic studies of the populations from the potential source areas, which, at present, are not available for Africa or most parts of Europe—in particular, Italy. Considering that 30% of the European immigrants (including the Portuguese colonizers) to Brazil came from Italy (Salzano and Freire Maia 1967; Callegari-Jacques and Salzano 1999), one can expect that a considerable number of mtDNA lineages in the Brazilian sample have Italian ancestry. In one case (a student in our laboratory), we could indeed confirm Italian matrilineal ancestry (BR137). Given the paucity of published Italian HVS-I mtDNA data (Francalacci et al. 1996; Torroni et al. 1996), we have practically no diagnostic haplotypes or characteristic haplogroup profiles at hand from which one could extrapolate the Italian mitochondrial input to the regional mtDNA pools of Brazil. It needs to be emphasized that genetic distances, although trivial to compute, between the Brazilian mtDNA sample and mtDNA samples representing potential source populations would not allow the calculation of reliable admixture proportions, as demonstrated by Rando et al. (1999) in the case of the mixed population from the Canary Islands.

One could also use a reverse approach and infer the mtDNA profile of a source population from that of the target mixed population (given sufficient information on the other participating source populations). For instance, no mtDNA data for Angola are available—yet, since Angola was the major source of African slaves brought to Brazil, we can make inferences on how the mtDNA pool of Angolans would look: we should expect (i) a considerable number of L3e lineages—in particular, those bearing the np-16327 transition, also observed in the Herero and in other southern African populations (Vigilant 1990; Soodyall 1993); (ii) a possibly equal amount of L1c lineages, several of which will show the transversions at np 16265 and 16286, detected in Equatorial Guinea (Pinto et al. 1996) as well as in Namibia (Soodyall 1993); and, furthermore, (iii) some L2 lineages (which seem to be omnipresent in Bantu populations) but probably no Khoisan-specific mtDNA haplotypes from the L1 subgroup described by Bandelt and Forster (1997). The seven northeastern-Brazilian lineages (except for the U6 lineage) could therefore represent a typical Angolan minisample. The white Brazilian population, paradoxically, seems to be an excellent resource with which to study the phylogeny of western- and central-African mtDNA.

In conclusion, our mtDNA study of a random sample of white Brazilians has revealed an astonishingly high matrilineal contribution of Amerindians and Africans. Present-day Brazilians thus still carry the genetic imprint of the early-colonization phase: the pioneer-colonial population typically had Amerindian ancestry—and, after few generations, increasingly African ancestry—in the maternal line but Portuguese ancestry in the paternal line (as is reflected by Y-chromosome markers [D. R. Carvalho-Silva, F. R. Santos, and S. D. J. Pena, unpublished results]).

Acknowledgments

We would like to thank Katia Barroso and Neuza Antunes Rodrigues for technical assistance and Toomas Kivisild (Tartu) for helpful information on mtDNA classification. This research was supported by grants from Conselho Nacional de Pesquisa, Fundação de Amparo à Pesquisa do Estado de Minas Gerais, and Pró-Reitoria de Pesquisa da Universidade Federal de Minas Gerais and a travel grant from Deutscher Akademischer Austauschdienst and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (to H.-J.B. and S.D.J.P.).

Electronic-Database Information

Accession numbers and URLs for data in this article are as follows:

  1. GenBank Overview, http://www.ncbi.nlm.nih.gov/Genbank/GenbankOverview.html (for HVS-I [accession numbers AF243627–AF243796] and HVS-II [accession numbers AF243539–AF243626])
  2. Instituto Brasileiro de Geografia Estatística, http://www.ibge.gov.br/

References

  1. Alves-Silva J, Guimarães PE, Rocha J, Pena SD, Prado VF (1999) Identification in Portugal and Brazil of a mtDNA lineage containing a 9-bp triplication of the intergenic COII/tRNALys region. Hum Hered 49:56–58 [DOI] [PubMed] [Google Scholar]
  2. Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N (1999) Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet 23:147 [DOI] [PubMed] [Google Scholar]
  3. Arpini-Sampaio Z, Costa MC, Melo AA, Carvalho MF, Deus MS, Simões AL (1999) Genetic polymorphisms and ethnic admixture in African-derived black communities of northeastern Brazil. Hum Biol 71:69–85 [PubMed] [Google Scholar]
  4. Bailliet G, Rothhammer F, Carnese FR, Bravi CM, Bianchi NO (1994) Founder mitochondrial haplotypes in Amerindian populations. Am J Hum Genet 55:27–33 [PMC free article] [PubMed] [Google Scholar]
  5. Bandelt H-J, Forster P (1997) The myth of bumpy hunter-gatherer mismatch distributions. Am J Hum Genet 61:980–983 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Batista dos Santos SE, Rodrigues JD, Ribeiro-dos-Santos AKC, Zago MA (1999) Differential contribution of indigenous men and women to the formation of an urban population in the Amazon region as revealed by mtDNA and Y- DNA. Am J Phys Anthropol 109:175–180 [DOI] [PubMed] [Google Scholar]
  7. Bethell L (1997) Nota sobre as populações americanas às vesperas das invasões européias. In: Bethel L (ed) América Latina colonial. Editora da Universidade de São Paulo, São Paulo, pp 129–131 [Google Scholar]
  8. Bianchi NO, Bailliet G, Bravi CM (1995) Peopling of the Americas as inferred through the analysis of mitochondrial DNA. Braz J Genet 18:661–668 [Google Scholar]
  9. Bortolini MC, Baptista C, Callegari-Jacques SM, Weimer TA, Salzano FM (1998a) Diversity in protein, nuclear DNA, and mtDNA in South Amerinds—agreement or discrepancy? Ann Hum Genet 62:133–145 [DOI] [PubMed] [Google Scholar]
  10. Bortolini MC, da Silva-Junior WA, Weimer TdA, Zago MA, de Guerra DC, Schneider MP, Layrisse Z, et al (1998b) Protein and hypervariable tandem repeat diversity in eight African-derived South American populations: inferred relationships do not coincide. Hum Biol 70:443–461 [PubMed] [Google Scholar]
  11. Bortolini MC, Salzano FM (1996) mtDNA diversity analysis in Amerindians and other human populations—how different are they? Braz J Genet 19:527–534 [Google Scholar]
  12. Bortolini MC, Salzano FM, Zago MA, Da Silva Junior WA, Weimer TdA (1997a) Genetic variability in two Brazilian ethnic groups: a comparison of mitochondrial and protein data. Am J Phys Anthropol 103:147–156 [DOI] [PubMed] [Google Scholar]
  13. Bortolini MC, Weimer TA, Franco MH, Salzano FM, Layrisse Z, Schneider H, Schneider MP, et al (1992) Genetic studies in three South American black populations. Gene Geogr 6:1–16 [PubMed] [Google Scholar]
  14. Bortolini MC, Weimer TDA, Salzano FM, Callegari-Jacques SM, Schneider H, Layrisse Z, Bonatto SL (1995) Evolutionary relationships between black South American and African populations. Hum Biol 67:547–559 [PubMed] [Google Scholar]
  15. Bortolini MC, Zago MA, Salzano FM, Silva-Junior WA, Bonatto SL, da Silva MC, Weimer TA (1997b) Evolutionary and anthropological implications of mitochondrial DNA variation in African Brazilian populations. Hum Biol 69:141–159 [PubMed] [Google Scholar]
  16. Bravi CM, Sans M, Bailliet G, Martinez-Marignac VL, Portas M, Barreto I, Bonilla C, et al (1997) Characterization of mitochondrial DNA and Y-chromosome haplotypes in a Uruguayan population of African ancestry. Hum Biol 69:641–652 [PubMed] [Google Scholar]
  17. Brown MD, Hosseini SH, Torroni A, Bandelt H-J, Allen JC, Schurr TG, Scozzari R, et al (1998) mtDNA haplogroup X: an ancient link between Europe/western Asia and North America? Am J Hum Genet 63:1852–1861 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Callegari-Jacques SM, Salzano FM (1999) Brazilian Indian/non-Indian interactions and their effects. Ciênc Cult 51:166–174 [Google Scholar]
  19. Chen YS, Torroni A, Excoffier L, Santachiara-Benerecetti AS, Wallace DC (1995) Analysis of mtDNA variation in African populations reveals the most ancient of all human continent-specific haplogroups. Am J Hum Genet 57:133–149 [PMC free article] [PubMed] [Google Scholar]
  20. Conceição MM, Salzano FM, Franco MHLP, Weimer TA, Krieger H (1987) Demography, genetics, and race admixture in Aracaju, Brazil. Braz J Genet 10:313–331 [Google Scholar]
  21. Côrte-Real HB, Macaulay VA, Richards MB, Hariti G, Issad MS, Cambon-Thomsen A, Papiha S, et al (1996) Genetic diversity in the Iberian Peninsula determined from mitochondrial sequence analysis. Ann Hum Genet 60:331–350 [DOI] [PubMed] [Google Scholar]
  22. Curtin PD (1969) The Atlantic slave trade: a census. University of Wisconsin Press, Madison [Google Scholar]
  23. Dornelles CL, Callegari-Jacques SM, Robinson WM, Weimer TA, Franco MHLP, Hickmann AC, Geiger CJ, et al (1999) Genetics, surnames, grandparents' nationalities, and ethnic admixture in Southern Brazil: do the patterns of variation coincide? Genet Mol Biol 22:151–161 [Google Scholar]
  24. Easton RD, Merriwether DA, Crews DE, Ferrell RE (1996) mtDNA variation in the Yanomami: evidence for additional New World founding lineages. Am J Hum Genet 59:213–225 [PMC free article] [PubMed] [Google Scholar]
  25. Forster P, Harding R, Torroni A, Bandelt H-J (1996) Origin and evolution of Native American mtDNA variation: a reappraisal. Am J Hum Genet 59:935–945 [PMC free article] [PubMed] [Google Scholar]
  26. Francalacci P, Bertranpetit J, Calafell F, Underhill PA (1996) Sequence diversity of the control region of mitochondrial DNA in Tuscany and its implications for the peopling of Europe. Am J Phys Anthropol 100:443–460 [DOI] [PubMed] [Google Scholar]
  27. Franco MH, Weimer TA, Salzano FM (1982) Blood polymorphisms and racial admixture in two Brazilian populations. Am J Phys Anthropol 58:127–132 [DOI] [PubMed] [Google Scholar]
  28. Ginther C, Corach D, Penacino GA, Rey JA, Carnese FR, Hutz MH, Anderson A, et al (1993) Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes. EXS 67:211–219 [DOI] [PubMed] [Google Scholar]
  29. Graven L, Passarino G, Semino O, Boursot P, Santachiara-Benerecetti S, Langaney A, Excoffier L (1995) Evolutionary correlation between control region sequence and restriction polymorphisms in the mitochondrial genome of a large Senegalese Mandenka sample. Mol Biol Evol 12:334–345 [DOI] [PubMed] [Google Scholar]
  30. Green LD, Derr JN, Knight A (2000) mtDNA affinities of the peoples of north-central Mexico. Am J Hum Genet 66:989–998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Guerreiro JF, Ribeiro-dos-Santos AKC, Santos EJM, Vallinoto ACR, Cayres-Vallinoto IMV, Aguiar GFS, Santos SEB (1999) Genetical-demographic data from two Amazonian populations composed of descendants of African slaves: Pacoval and Curiau. Genet Mol Biol 22:163–167 [Google Scholar]
  32. Helgason A, Sigurðardóttir S, Gulcher JR, Ward R, Stefánsson K (2000) mtDNA and the origin of the Icelanders: deciphering signals of recent population history. Am J Hum Genet 66:999–1016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Horai S, Hayasaka K (1990) Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA. Am J Hum Genet 46:828–842 [PMC free article] [PubMed] [Google Scholar]
  34. Horai S, Hayasaka K, Kondo R, Tsugane K, Takahata N (1995) Recent African origin of modern humans revealed by complete sequences of hominoid mitochondrial DNAs. Proc Natl Acad Sci USA 92:532–536 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Horai S, Kondo R, Nakagawa-Hattori Y, Hayashi S, Sonoda S, Tajima K (1993) Peopling of the Americas, founded by four major lineages of mitochondrial DNA. Mol Biol Evol 10:23–47 [DOI] [PubMed] [Google Scholar]
  36. Horai S, Murayama K, Hayasaka K, Matsubayashi S, Hattori Y, Fucharoen G, Harihara S, et al (1996) mtDNA polymorphism in East Asian populations, with special reference to the peopling of Japan. Am J Hum Genet 59:579–590 [PMC free article] [PubMed] [Google Scholar]
  37. Kivisild T, Bamshad MJ, Kaldma K, Metspalu M, Metspalu E, Reidla M, Laos S, et al (1999a) Deep common ancestry of Indian and western-Eurasian mitochondrial DNA lineages. Curr Biol 9:1331–1334 [DOI] [PubMed] [Google Scholar]
  38. Kivisild T, Kaldma K, Metspalu M, Parik J, Papiha S, Villems R (1999b) The place of the Indian mitochondrial DNA variants in the global network of maternal lineages and the peopling of the old world. In: Papiha G, Deka R, Chakraborty R (eds) Genomic diversity: applications in human population genetics. Kluwer Academic/Plenum, New York, pp 135–152 [Google Scholar]
  39. Kolman CJ, Bermingham E (1997) Mitochondrial and nuclear DNA diversity in the Choco and Chibcha Amerinds of Panama. Genetics 147:1289–1302 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Kolman CJ, Sambuughin N, Bermingham E (1996) Mitochondrial DNA analysis of Mongolian populations and implications for the origin of New World founders. Genetics 142:1321–1334 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Krieger H, Morton NE, Mi MP, Azevedo E, Freire-Maia A, Yasuda N (1965) Racial admixture in north-eastern Brazil. Ann Hum Genet 29:113–125 [DOI] [PubMed] [Google Scholar]
  42. Krings M, Geisert H, Schmitz RW, Krainitzki H, Pääbo S (1999) DNA sequence of the mitochondrial hypervariable region II from the Neandertal type specimen. Proc Natl Acad Sci USA 96:5581–5585 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Krings M, Stone A, Schmitz RW, Krainitzki H, Stoneking M, Pääbo S (1997) Neandertal DNA sequences and the origin of modern humans. Cell 90:19–30 [DOI] [PubMed] [Google Scholar]
  44. Lee SD, Shin CH, Kim KB, Lee YS, Lee JB (1997) Sequence variation of mitochondrial DNA control region in Koreans. Forensic Sci Int 87:99–116 [DOI] [PubMed] [Google Scholar]
  45. Macaulay V, Richards M, Hickey E, Vega E, Cruciani F, Guida V, Scozzari R, et al (1999) The emerging tree of West Eurasian mtDNAs: a synthesis of control-region sequences and RFLPs. Am J Hum Genet 64:232–249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Mateu E, Comas D, Calafell F, Perez-Lezaun A, Abade A, Bertranpetit J (1997) A tale of two islands: population history and mitochondrial DNA sequence variation of Bioko and São Tomé, Gulf of Guinea. Ann Hum Genet 61:507–518 [DOI] [PubMed] [Google Scholar]
  47. Metspalu E, Kivisild T, Kaldma K, Parik J, Reidla M, Tambets K, Villems R (1999) The trans-Caucasus and the expansion of the caucasoid-specific human mitochondrial DNA. In: Papiha G, Deka R, Chakraborty R (eds) Genomic diversity: applications in human population genetics. Kluwer Academic/Plenum, New York, pp 121–133 [Google Scholar]
  48. Meyer S, Weiss G, von Haeseler A (1999) Pattern of nucleotide substitution and rate heterogeneity in the hypervariable regions I and II of human mtDNA. Genetics 152:1103–1110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Monteiro JM (1994) Negros da terra, índios e bandeirantes nas origens de São Paulo. Companhia da Letras, São Paulo [Google Scholar]
  50. Moraes ME, Fernandez-Vina M, Salatiel I, Tsai S, Moraes JR, Stastny P (1993) HLA class II DNA typing in two Brazilian populations. Tissue Antigens 41:238–242 [DOI] [PubMed] [Google Scholar]
  51. Mörner M (1967) Race mixture in the history of Latin America. Little, Brown, Boston [Google Scholar]
  52. Piercy R, Sullivan KM, Benson N, Gill P (1993) The application of mitochondrial DNA typing to the study of white Caucasian genetic identification. Int J Legal Med 106:85–90 [DOI] [PubMed] [Google Scholar]
  53. Pinto F, Gonzalez AM, Hernandez M, Larruga JM, Cabrera VM (1996) Genetic relationship between the Canary Islanders and their African and Spanish ancestors inferred from mitochondrial DNA sequences. Ann Hum Genet 60:321–330 [DOI] [PubMed] [Google Scholar]
  54. Rando JC, Cabrera VM, Larruga JM, Hernández M, González AM, Pinto F, Bandelt H-J (1999) Phylogeographic patterns of mtDNA reflecting the colonisation of the Canary Islands. Ann Hum Genet 63:413–428 [DOI] [PubMed] [Google Scholar]
  55. Rando JC, Pinto F, González AM, Hernández M, Larruga JM, Cabrera VM, Bandelt H-J (1998) Mitochondrial DNA analysis of northwest African populations reveals genetic exchanges with European, near-eastern, and sub-Saharan populations. Ann Hum Genet 62:531–550 [DOI] [PubMed] [Google Scholar]
  56. Ribeiro D (1995) O povo brasileiro: a formação e o sentido do Brasil. Companhia da Letras, São Paulo [Google Scholar]
  57. Richards M, Côrte-Real H, Forster P, Macaulay V, Wilkinson-Herbots H, Demaine A, Papiha S, et al (1996) Paleolithic and Neolithic lineages in the European mitochondrial gene pool. Am J Hum Genet 59:185–203 [PMC free article] [PubMed] [Google Scholar]
  58. Richards MB, Macaulay VA, Bandelt H-J, Sykes BC (1998) Phylogeography of mitochondrial DNA in western Europe. Ann Hum Genet 62:241–260 [DOI] [PubMed] [Google Scholar]
  59. Rickards O, Martinez-Labarga C, Lum JK, De Stefano GF, Cann RL (1999) mtDNA history of the Cayapa Amerinds of Ecuador: detection of additional founding lineages for the Native American populations. Am J Hum Genet 65:519–530 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Rosa VL, Salzano FM, Franco MH, Freitas MJ (1984) Blood genetic studies in five Amazonian populations. Braz J Genet 75:69–82 [Google Scholar]
  61. Sajantila A, Lahermo P, Anttinen T, Lukka M, Sistonen P, Savontaus ML, Aula P, et al (1995) Genes and languages in Europe: an analysis of mitochondrial lineages. Genome Res 5:42–52 [DOI] [PubMed] [Google Scholar]
  62. Salas A, Comas D, Lareu MV, Bertranpetit J, Carracedo A (1998) mtDNA analysis of the Galician population: a genetic edge of European variation. Eur J Hum Genet 6:365–375 [DOI] [PubMed] [Google Scholar]
  63. Salzano FM (1997) Human races: myth, invention or reality? Interciência 22:221–227 [Google Scholar]
  64. Salzano FM, Freire-Maia N (1967) Populações brasileiras, aspectos demográficos, genéticos e antropológicos. Companhia Editora Nacional, São Paulo [Google Scholar]
  65. ——— (1970) Problems in human biology: a study of Brazilian populations. Wayne State University Press, Detroit [Google Scholar]
  66. Santos EJM, Ribeiro-dos-Santos AKC, Guerreiro JF, Aguiar GFS, Santos SEB (1996a) Migration and ethnic change in an admixed population from the Amazon region (Santarém, Pará). Braz J Genet 19:511–515 [Google Scholar]
  67. Santos SEB, Guerreiro JF (1995) The indigenous contribution to the formation of the population of the Brazilian Amazon region. Braz J Genet 18:311–315 [Google Scholar]
  68. Santos SE, Ribeiro dos Santos AKC, Meyer D, Zago MA (1996b) Multiple founder haplotypes of mitochondrial DNA in Amerindians revealed by RFLP and sequencing. Ann Hum Genet 60:305–319 [DOI] [PubMed] [Google Scholar]
  69. Santos SEB, Ribeiro dos Santos AKC, Santos EJM, Guerreiro JF (1999) The Amazonian microcosm. Ciênc Cult 51:181–190 [Google Scholar]
  70. Schneider H, Guerreiro JF, Santos SEB, Weimer TA, Schneider MPC, Salzano FM (1987) Isolate breakdown in Amazonia: the blacks of the Trombetas river. Braz J Genet 10:565–574 [Google Scholar]
  71. Schurr TG, Ballinger SW, Gan YY, Hodge JA, Merriwether DA, Lawrence DN, Knowler WC, et al (1990) Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages. Am J Hum Genet 46:613–623 [PMC free article] [PubMed] [Google Scholar]
  72. Smith DG, Malhi RS, Eshleman J, Lorenz JG, Kaestle FA (1999) Distribution of mtDNA haplogroup X among Native North Americans. Am J Phys Anthropol 110:271–284 [DOI] [PubMed] [Google Scholar]
  73. Soodyall H (1993) Mitochondrial DNA polymorphisms in southern African populations. PhD thesis, University of Witwatersrand, Johannesburg [Google Scholar]
  74. Soodyall H, Vigilant L, Hill AV, Stoneking M, Jenkins T (1996) mtDNA control-region sequence variation suggests multiple independent origins of an “Asian-specific” 9-bp deletion in sub-Saharan Africans. Am J Hum Genet 58:595–608 [PMC free article] [PubMed] [Google Scholar]
  75. Stone AC, Stoneking M (1998) mtDNA analysis of a prehistoric Oneota population: implications for the peopling of the New World. Am J Hum Genet 62:1153–1170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Stoneking M, Hedgecock D, Higuchi RG, Vigilant L, Erlich HA (1991) Population variation of human mtDNA control region sequences detected by enzymatic amplification and sequence-specific oligonucleotide probes. Am J Hum Genet 48:370–382 [PMC free article] [PubMed] [Google Scholar]
  77. Torroni A, Bandelt H-J, D'Urbano L, Lahermo P, Moral P, Sellitto D, Rengo C, et al (1998) mtDNA analysis reveals a major late Paleolithic population expansion from southwestern to northeastern Europe. Am J Hum Genet 62:1137–1152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Torroni A, Brown MD, Lott MT, Newman NJ, Wallace D, Cuba Neuropathy Field Investigation Team (1995) African, Native American, and European mitochondrial DNAs in Cubans from Pinar del Rio Province and implications for the recent epidemic neuropathy in Cuba. Hum Mutat 5:310–317 [DOI] [PubMed] [Google Scholar]
  79. Torroni A, Huoponen K, Francalacci P, Petrozzi M, Morelli L, Scozzari R, Obinu D, et al (1996) Classification of European mtDNAs from an analysis of three European populations. Genetics 144:1835–1850 [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Torroni A, Lott MT, Cabell MF, Chen YS, Lavergne L, Wallace DC (1994) mtDNA and the origin of Caucasians: identification of ancient Caucasian-specific haplogroups, one of which is prone to a recurrent somatic duplication in the D-loop region. Am J Hum Genet 55:760–776 [PMC free article] [PubMed] [Google Scholar]
  81. Torroni A, Schurr TG, Cabell MF, Brown MD, Neel JV, Larsen M, Smith DG, et al (1993) Asian affinities and continental radiation of the four founding Native American mtDNAs. Am J Hum Genet 53:563–590 [PMC free article] [PubMed] [Google Scholar]
  82. Torroni A, Schurr TG, Yang CC, Szathmary EJ, Williams RC, Schanfield MS, Troup GA, et al (1992) Native American mitochondrial DNA analysis indicates that the Amerind and the Nadene populations were founded by two independent migrations. Genetics 130:153–162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Vigilant L (1990) Control region sequences from African population and the evolution of human mitochondrial DNA. PhD thesis, University of California, Berkeley [Google Scholar]
  84. Vigilant L, Stoneking M, Harpending H, Hawkes K, Wilson AC (1991) African populations and the evolution of human mitochondrial DNA. Science 253:1503–1507 [DOI] [PubMed] [Google Scholar]
  85. Ward RH, Salzano FM, Bonatto SL, Hutz MH, Coimbra CEA Jr, Santos RV (1996) Mitochondrial DNA polymorphism in three Brazilian tribes. Am J Hum Biol 8:317–323 [DOI] [PubMed] [Google Scholar]
  86. Watson E, Forster P, Richards M, Bandelt H-J (1997) Mitochondrial footprints of human expansions in Africa. Am J Hum Genet 61:691–704 [DOI] [PMC free article] [PubMed] [Google Scholar]

Read the original on pmc.ncbi.nlm.nih.gov ↗